ID: 1067792869

View in Genome Browser
Species Human (GRCh38)
Location 10:49301030-49301052
Sequence CCTGGAGACCCTTACTGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067792861_1067792869 24 Left 1067792861 10:49300983-49301005 CCAGGACAGAAGTAAGTGTCTTT 0: 1
1: 0
2: 2
3: 16
4: 173
Right 1067792869 10:49301030-49301052 CCTGGAGACCCTTACTGAAGAGG No data
1067792864_1067792869 -6 Left 1067792864 10:49301013-49301035 CCTGACCCTAAGGAAGCCCTGGA 0: 1
1: 0
2: 3
3: 13
4: 203
Right 1067792869 10:49301030-49301052 CCTGGAGACCCTTACTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067792869 Original CRISPR CCTGGAGACCCTTACTGAAG AGG Intronic
No off target data available for this crispr