ID: 1067796402

View in Genome Browser
Species Human (GRCh38)
Location 10:49325222-49325244
Sequence GAATTGCCAAGGCCAGAATG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 213}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067796391_1067796402 21 Left 1067796391 10:49325178-49325200 CCATGTCCTTGGAGGACTCCCTC 0: 1
1: 0
2: 1
3: 17
4: 216
Right 1067796402 10:49325222-49325244 GAATTGCCAAGGCCAGAATGGGG 0: 1
1: 1
2: 0
3: 7
4: 213
1067796389_1067796402 29 Left 1067796389 10:49325170-49325192 CCTGAGGACCATGTCCTTGGAGG 0: 1
1: 0
2: 1
3: 7
4: 134
Right 1067796402 10:49325222-49325244 GAATTGCCAAGGCCAGAATGGGG 0: 1
1: 1
2: 0
3: 7
4: 213
1067796394_1067796402 3 Left 1067796394 10:49325196-49325218 CCCTCAGCAGTGGCCACAAAGAG 0: 1
1: 0
2: 1
3: 19
4: 247
Right 1067796402 10:49325222-49325244 GAATTGCCAAGGCCAGAATGGGG 0: 1
1: 1
2: 0
3: 7
4: 213
1067796398_1067796402 -10 Left 1067796398 10:49325209-49325231 CCACAAAGAGGAGGAATTGCCAA 0: 1
1: 0
2: 2
3: 71
4: 240
Right 1067796402 10:49325222-49325244 GAATTGCCAAGGCCAGAATGGGG 0: 1
1: 1
2: 0
3: 7
4: 213
1067796395_1067796402 2 Left 1067796395 10:49325197-49325219 CCTCAGCAGTGGCCACAAAGAGG 0: 1
1: 0
2: 1
3: 25
4: 269
Right 1067796402 10:49325222-49325244 GAATTGCCAAGGCCAGAATGGGG 0: 1
1: 1
2: 0
3: 7
4: 213
1067796392_1067796402 15 Left 1067796392 10:49325184-49325206 CCTTGGAGGACTCCCTCAGCAGT 0: 1
1: 0
2: 0
3: 14
4: 175
Right 1067796402 10:49325222-49325244 GAATTGCCAAGGCCAGAATGGGG 0: 1
1: 1
2: 0
3: 7
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067796402 Original CRISPR GAATTGCCAAGGCCAGAATG GGG Exonic
901386615 1:8913717-8913739 TGTTTGCCAAAGCCAGAATGGGG - Intergenic
902429251 1:16350163-16350185 GAATTGCAAAGGTCAAAATCTGG + Intronic
903782364 1:25829244-25829266 TAAATGCCAAGGCCATTATGGGG + Intronic
904602001 1:31678447-31678469 GAATTGACAATGCTAGACTGGGG - Intronic
906056578 1:42922863-42922885 GGTCTGCAAAGGCCAGAATGTGG + Intergenic
907389488 1:54148638-54148660 TATTTGGCAAGTCCAGAATGTGG + Intronic
910574918 1:88750491-88750513 GATTTCCCAAGGCCAGAATAAGG - Intronic
910772971 1:90848232-90848254 TAATATTCAAGGCCAGAATGTGG - Intergenic
914666634 1:149838203-149838225 AGATGGCCAAGGCCAGCATGGGG + Intergenic
914669133 1:149855593-149855615 AGATGGCCAAGGCCAGCATGGGG - Intronic
916681491 1:167109151-167109173 AAATTGTCCAGGGCAGAATGGGG + Intronic
917452442 1:175158217-175158239 GAAGAGCCAAACCCAGAATGGGG - Intronic
917495920 1:175540139-175540161 GAATTGCCATGGTAATAATGTGG - Intronic
918524272 1:185448217-185448239 ATATGGCCAAAGCCAGAATGTGG + Intergenic
918770488 1:188551643-188551665 AAATTGGCAAAGCCAGAAAGAGG - Intergenic
920232939 1:204482268-204482290 GAATAGCCAAGGCCAGGGTTTGG - Intronic
923806327 1:237261789-237261811 GAATTGCCAGGGCCTCATTGAGG - Intronic
924720910 1:246622129-246622151 GATTAGCCAAGGCCAAGATGTGG - Intronic
1064588731 10:16866062-16866084 GAGTTGCCAAGGAGAGACTGAGG - Intronic
1067796402 10:49325222-49325244 GAATTGCCAAGGCCAGAATGGGG + Exonic
1068078456 10:52288453-52288475 GAATGACCAAGGACAGCATGAGG + Intronic
1068411471 10:56660915-56660937 GAATTGCCAATCCCAGAAGTAGG - Intergenic
1070520280 10:77246804-77246826 CAATTGCCAAGGCAACAGTGGGG - Intronic
1072005630 10:91244129-91244151 AAATTGCAAAGGCAAGAAAGAGG + Intronic
1073689511 10:105792298-105792320 GAATTGCAAAGGCCCCAAGGTGG - Intergenic
1074895545 10:117774058-117774080 AAATCTCCAAGGCCAGGATGTGG + Intergenic
1076503971 10:130959609-130959631 TATTTCCCAAGTCCAGAATGAGG + Intergenic
1078044736 11:7903447-7903469 TAATTGCAAGGGCCAGGATGGGG + Intergenic
1079730242 11:23931715-23931737 GAATAGGAAAGGCCTGAATGGGG + Intergenic
1080742150 11:35076385-35076407 GAACTGCCAAGCCCAAGATGAGG + Intergenic
1081745678 11:45470885-45470907 GAATTACCAAGACCAGCAGGGGG - Intergenic
1083354192 11:62053566-62053588 TAATTGCAAGGGCCAGGATGGGG + Intergenic
1083626391 11:64074087-64074109 GAGGAGGCAAGGCCAGAATGGGG - Intronic
1084510538 11:69600880-69600902 GAATTTCCGAGGTCTGAATGTGG - Intergenic
1085951420 11:81337079-81337101 GAATTGCCAAGGGCAATTTGGGG - Intergenic
1086416825 11:86597182-86597204 GCATTGCCAAGGCAGGGATGTGG + Intronic
1088760817 11:112927347-112927369 TAATTGCAAGGGCCAGGATGGGG + Intergenic
1090283613 11:125479937-125479959 GATTTGCAAAGGCCATAAAGGGG - Intronic
1097952439 12:65446852-65446874 GAATTGACAAGAGCAAAATGGGG + Intronic
1099143203 12:79006339-79006361 AAATTGCCAAGGCCAAAGAGTGG + Intronic
1099729352 12:86478628-86478650 GAATTGCCATGGGCAGTAAGTGG - Intronic
1099884967 12:88517700-88517722 TAATTTCCAAAGTCAGAATGTGG - Intronic
1100647079 12:96542952-96542974 AAATGGCCAAATCCAGAATGTGG - Intronic
1100858087 12:98776047-98776069 ATATTGCCAATGCTAGAATGGGG + Intronic
1101595525 12:106161225-106161247 TAATTGACAAGGGCAGCATGTGG - Intergenic
1102115920 12:110403053-110403075 GGTTTCCCAAGGCCAGAAAGTGG + Intronic
1102210521 12:111123570-111123592 GTATTGCCCAGGCTGGAATGCGG + Intronic
1105488158 13:20858515-20858537 GTGTTGCCCAGGCCAGAATGTGG - Intronic
1106190448 13:27448447-27448469 GCACTGCTCAGGCCAGAATGGGG - Intronic
1107426378 13:40297176-40297198 CAATGGCCAAGGCCGGAATCTGG + Intergenic
1107575020 13:41709323-41709345 TCATTGCCACGGCCACAATGTGG + Intronic
1111677311 13:91403149-91403171 AAATTTCCAAAGCCAGAATTGGG + Intronic
1112251111 13:97781561-97781583 CATTTGCCCAGGCAAGAATGTGG + Intergenic
1112506002 13:99975844-99975866 GAGTTGCCAAGGCCGGAAGGTGG - Intergenic
1115139585 14:30154850-30154872 GAATTACCATGGGCAGAGTGAGG + Intronic
1117146122 14:52838345-52838367 GAACTGGCAAGGAGAGAATGAGG - Intergenic
1117313807 14:54554671-54554693 GGATTGCCAGGGCTAGAATCAGG - Intergenic
1119169739 14:72525436-72525458 GCATGCTCAAGGCCAGAATGAGG + Intronic
1121197551 14:92087559-92087581 GAATGGACAAGGCCAAGATGTGG + Intronic
1122584649 14:102796832-102796854 GAATTCAAAAGGACAGAATGAGG - Intronic
1122590732 14:102848783-102848805 AAACAGCAAAGGCCAGAATGAGG - Intronic
1126453355 15:48834540-48834562 GAATTGAAAAGGGCAGAAAGAGG + Intronic
1126914588 15:53451715-53451737 GAATGGCCAAAGCCAGTATAGGG - Intergenic
1127185686 15:56477761-56477783 AAATTCCCAAGGCAAGAAAGTGG - Intergenic
1129245917 15:74278550-74278572 CATCTGCCAAGGCCAGAAGGTGG - Intronic
1129386173 15:75197274-75197296 GACATGCCAAAGCCAGACTGGGG + Intronic
1129666054 15:77579946-77579968 GCATTGACGAGGCCAGCATGGGG - Intergenic
1130911331 15:88272845-88272867 GAATTTGCAAGCCCAGGATGGGG - Intergenic
1131207582 15:90464083-90464105 AATTTGCCAAGGCATGAATGAGG - Intronic
1131294275 15:91133582-91133604 AAAATGCCCAGGCCAGAGTGGGG + Intronic
1135346870 16:21696236-21696258 GAATTTCAAAAGCCAGAACGGGG + Intronic
1136908238 16:34122283-34122305 GAATGGCCAAGCCAATAATGAGG + Intergenic
1139320959 16:66113561-66113583 GAATTCACAAGGAGAGAATGAGG + Intergenic
1141589101 16:85055979-85056001 GCACTGGCAAGGCCAGGATGGGG - Intronic
1143680813 17:8474911-8474933 GAATTTGCAAGGTCAGCATGAGG + Exonic
1147177322 17:38663996-38664018 GAATGGCCAAGGCATGCATGTGG - Intergenic
1148943186 17:51233684-51233706 AAATTTCCAAGACCAAAATGGGG + Intronic
1149987042 17:61355034-61355056 AAATTCCCAAGGCCAGCAGGGGG + Intronic
1151478934 17:74358860-74358882 ACATGGCCAAGGCCAGAATGAGG - Intronic
1155652684 18:28160298-28160320 CCATTGCCAAGGCCAAATTGCGG - Intronic
1160130061 18:76217746-76217768 GAATTGCCAAGACCTGCCTGTGG - Intergenic
1161966780 19:7553518-7553540 GAGGAACCAAGGCCAGAATGAGG + Intronic
1164639541 19:29813552-29813574 GAACTTCCAGGGCCAGAAAGAGG - Intronic
1166763832 19:45240865-45240887 CTATTGCCCAGGCCAGAATGCGG - Intronic
1167307738 19:48719028-48719050 TCATTGCCAAGGCCGGGATGGGG + Exonic
1167808662 19:51809321-51809343 TAATTGCAAGGGCCAGGATGGGG + Intronic
1168691520 19:58380555-58380577 AAAGTGCAAAGGCCAGGATGCGG + Intronic
925011881 2:492206-492228 GAGATGCCCAAGCCAGAATGAGG - Intergenic
926791263 2:16574453-16574475 TAATTGCCAAGACAACAATGGGG + Intronic
927193429 2:20532397-20532419 AAACTGTCAAGGCCAGAAGGTGG - Intergenic
928955283 2:36860266-36860288 GACTGGCCTAGGACAGAATGAGG + Intronic
930369686 2:50487351-50487373 TAATTGCAAAGGCCAAAAAGGGG + Intronic
930688012 2:54330143-54330165 GAAATTCCAGGGCCAGAAGGTGG + Intronic
935501574 2:103847108-103847130 GAATTGCAAAGGCCTGCATTGGG - Intergenic
936947036 2:117940434-117940456 GGACTGGCAAGGCCAGAGTGAGG + Intronic
937427014 2:121808273-121808295 GAAGTGCTAATGTCAGAATGGGG + Intergenic
937921825 2:127136634-127136656 GAAGAGCCAAGGCCTGAAAGGGG + Intergenic
938611513 2:132952414-132952436 GCATTGCCAGGGCCAGATTTAGG - Intronic
938929522 2:136074501-136074523 TAATTGCAAGGGCCAGGATGGGG + Intergenic
940483965 2:154274540-154274562 GAAGTGCCAAGAGCAGCATGGGG - Intronic
944464457 2:199986075-199986097 GAATTGACAAGGCAAAAAAGGGG - Intronic
1171474746 20:25399840-25399862 TAATTGCAAGGGCCAGGATGGGG + Intergenic
1172065760 20:32219130-32219152 GAATGAACAAGGCCAGAATAAGG + Intronic
1173021416 20:39270837-39270859 TAATTCCCCAGGACAGAATGGGG - Intergenic
1173910140 20:46662144-46662166 GAAATGCCAAGATCATAATGGGG - Intronic
1174060309 20:47827664-47827686 GAATTCCCAAGGCAGGACTGAGG - Intergenic
1174071588 20:47903706-47903728 GAATTCCCAAGGCAGGACTGAGG + Intergenic
1174152461 20:48494929-48494951 GAATTCCCAAGGCAGGACTGAGG - Intergenic
1174839764 20:53890861-53890883 GGCTCACCAAGGCCAGAATGGGG - Intergenic
1175077793 20:56390634-56390656 CCATTGCCCAGGCCAGAGTGCGG - Intronic
1177814173 21:25958140-25958162 GTAATGCCAAGGCCAGCCTGGGG - Intronic
1178757727 21:35368456-35368478 GCAGAGCCAAGGCCAGTATGAGG + Intronic
1179402123 21:41094082-41094104 AATTTGTCAGGGCCAGAATGGGG + Intergenic
1183133010 22:35857626-35857648 AAATAGCCATGGCCATAATGGGG + Intronic
1183172538 22:36198779-36198801 ACATGGCCAAGACCAGAATGGGG + Intronic
1184752331 22:46494284-46494306 GAATAGCCAAGGCCACTTTGAGG - Intronic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
1185138569 22:49087858-49087880 GGATGGCCCAGGCCAGCATGGGG + Intergenic
950206455 3:11084737-11084759 GAATCGCCCAGGCCAGGCTGTGG + Intergenic
950623568 3:14227206-14227228 TAATTGCAAGGGCCAGGATGGGG - Intergenic
951757083 3:26102839-26102861 TAACTGCCAAGGCCAGGTTGAGG - Intergenic
952287641 3:31983503-31983525 GAATAGTCAAGGCCAGGATGGGG + Intronic
952819816 3:37476632-37476654 GAAGTGCCGAGGACAGAGTGGGG - Intronic
953578558 3:44133181-44133203 GTATTAACAAGGCCAGAATATGG + Intergenic
953803873 3:46051447-46051469 TAATTGCAAGGGCCAGGATGGGG + Intergenic
954452617 3:50579898-50579920 GGGGTGCCAAGGCCAGAATGTGG - Exonic
961043140 3:123691601-123691623 CAATTGTAAAGTCCAGAATGAGG + Intronic
961783859 3:129337708-129337730 AAATGGCTCAGGCCAGAATGTGG - Intergenic
961785154 3:129343145-129343167 AAATGGCTTAGGCCAGAATGTGG - Intergenic
961858408 3:129894484-129894506 GTCTTGGCATGGCCAGAATGGGG + Intergenic
962068288 3:132006753-132006775 GGATTTCCAAGGTCACAATGGGG + Intronic
963308674 3:143683369-143683391 GAAGTGACAAATCCAGAATGTGG + Intronic
964068584 3:152604980-152605002 AAATGGACAAGGCCAGAAAGGGG + Intergenic
966489751 3:180515170-180515192 GAATTGAGAAGGTGAGAATGGGG + Intergenic
968482908 4:844694-844716 GAAGTGCCAAGGCCAGAATGTGG + Intergenic
969329882 4:6468304-6468326 GAATTGCTAAGGTCATCATGGGG - Intronic
971887225 4:32466412-32466434 GCATTGCAAAGGGCAAAATGAGG + Intergenic
973318880 4:48789787-48789809 GAATTACCAGGGCAGGAATGTGG + Intergenic
974267649 4:59605463-59605485 GAATAGCCAAGGCCATGCTGAGG + Intergenic
975935379 4:79573188-79573210 GTATAGCCCAGGCCAGTATGAGG - Intergenic
976590598 4:86845773-86845795 GAGTGGCCATGGCGAGAATGAGG + Intronic
978944650 4:114481088-114481110 GAAATGCCAAGCACAAAATGTGG + Intergenic
979194679 4:117906169-117906191 GAATTGCCGAGGCCACACTAAGG + Intergenic
982328300 4:154152695-154152717 TATTGCCCAAGGCCAGAATGCGG - Intergenic
983035615 4:162862144-162862166 GAATTTCCATGGCCAATATGTGG - Intergenic
983780368 4:171663127-171663149 GAATTGCTAAAGGCTGAATGTGG + Intergenic
983889786 4:173018810-173018832 GAACAGCAAAGGCCAGATTGTGG + Intronic
984538886 4:181012672-181012694 GAGTTGGCAAAGTCAGAATGAGG + Intergenic
985082311 4:186278639-186278661 GAAATGTCAATGACAGAATGTGG + Intronic
986781138 5:11066801-11066823 GCAATGCTAATGCCAGAATGTGG + Intronic
986823918 5:11499885-11499907 TAATTGGCAAACCCAGAATGTGG - Intronic
989078066 5:37586123-37586145 GAATTGAGGATGCCAGAATGGGG - Intronic
989139395 5:38188493-38188515 GCATTTCCAAGGGCAAAATGTGG - Intergenic
989152898 5:38317813-38317835 GAATTGCAGAGGCCAGATTCTGG + Intronic
991912429 5:71574956-71574978 TAATTGCAAGGGCCAGGATGGGG - Intergenic
992128601 5:73668014-73668036 TAAGTGCCATGACCAGAATGTGG - Intronic
993292381 5:86091266-86091288 GAATTGCCAAGGAGATCATGAGG - Intergenic
993550044 5:89262101-89262123 GATTTGGCAAGGGCAGAGTGTGG - Intergenic
996612407 5:125398138-125398160 GAACTGCCAAGGGCACAAGGGGG + Intergenic
997201750 5:132013931-132013953 GAAATGCCCAGGCCAGGCTGGGG + Intergenic
997717009 5:136049881-136049903 GAATAGCCAAGGCCAGAGCAAGG + Intronic
997806550 5:136923752-136923774 GGAGTGACATGGCCAGAATGAGG - Intergenic
998562536 5:143184734-143184756 GACTTGCTAAGGCAAAAATGGGG - Intronic
998915883 5:147010959-147010981 GAAGTGCCAAGGCCTGAGTCAGG - Intronic
998955681 5:147435903-147435925 CCATTGCCAAGGCCAGAAGAGGG + Intronic
999096674 5:148984584-148984606 GCATTGCCTAGTCCAGAGTGAGG - Intronic
999185980 5:149709317-149709339 GTACAGCCAGGGCCAGAATGAGG + Intergenic
1001322336 5:170693115-170693137 GAAATGCCCAGCCCAGAATTGGG + Intronic
1002591441 5:180293464-180293486 GAGTGGCCAGGGCCAGAGTGGGG + Intergenic
1003194531 6:3903104-3903126 TAATTGCCAAGGACAGAGGGAGG - Intergenic
1003552435 6:7110198-7110220 GAACTGCCAAGAAAAGAATGTGG + Intronic
1004892528 6:20115106-20115128 GATTTGAGAAGGCCATAATGTGG - Intronic
1005466639 6:26122495-26122517 GAATTTCCCAGGCCACAAAGCGG + Intronic
1011948777 6:92938148-92938170 CAATTGGCAAGCCCAGTATGAGG - Intergenic
1013301613 6:108809524-108809546 GATTTGCCAGGGCCCTAATGTGG - Intergenic
1015129380 6:129792718-129792740 GAATTACTCTGGCCAGAATGAGG + Intergenic
1015183332 6:130384346-130384368 GGTTTGCCCAGGCCAGAAAGCGG + Intronic
1019120595 6:169800984-169801006 CAACTGCCAGGGCCAGACTGTGG + Intergenic
1019867982 7:3730831-3730853 GAATCTTCAAGGCCAGAGTGTGG - Intronic
1020476948 7:8607491-8607513 TAATAGCCAAGGGCAAAATGTGG - Intronic
1023908055 7:44536168-44536190 GAAGGGCCAGGGCCAGGATGGGG + Intronic
1024577980 7:50780412-50780434 GAAGGGTCAAGGGCAGAATGAGG - Intronic
1024584884 7:50833563-50833585 GAATTGCCAGGCACAGGATGGGG + Intergenic
1026341780 7:69440474-69440496 GAATTAGCTAGGCCAAAATGGGG + Intergenic
1026459758 7:70603544-70603566 GAAATGCCAAGTCAAGGATGTGG + Intronic
1026582629 7:71630992-71631014 GCATTCCCAGGGCCAGAATAGGG - Intronic
1026633456 7:72059433-72059455 CTTTTGCCAAGGCAAGAATGAGG - Intronic
1030133573 7:106223899-106223921 GAATTGAAAAGGCCACACTGAGG - Intergenic
1033569179 7:142610619-142610641 TAATTGCCCTGGCTAGAATGAGG - Intergenic
1035382004 7:158446345-158446367 GAAATTCCCAGGCCAGTATGAGG + Intronic
1035524571 8:302425-302447 GTGTTGTCAGGGCCAGAATGGGG - Intergenic
1036086311 8:5616852-5616874 TGACTGCCAAGGACAGAATGAGG - Intergenic
1038850971 8:31275975-31275997 GAATTGGGAAGGGCAGAAAGAGG - Intergenic
1039079688 8:33722547-33722569 GTATTGACAAGGCCAGAAGACGG + Intergenic
1039792051 8:40883901-40883923 GAATTAATAAGGCCAGGATGAGG - Intronic
1040345477 8:46488793-46488815 TAATTGCCCGGGCCAGGATGGGG + Intergenic
1040520731 8:48173920-48173942 GAATTGCCTTGGGCTGAATGTGG + Intergenic
1042459252 8:69043794-69043816 AAATTGCCTAGTCCAGCATGAGG + Intergenic
1042778786 8:72467011-72467033 GATTTACTAAAGCCAGAATGAGG + Intergenic
1045379188 8:101606055-101606077 AAATTTCCAAAGCAAGAATGAGG + Intronic
1047238711 8:123065550-123065572 TAATGGCCAAAGCCAGTATGTGG - Intronic
1048131921 8:131707152-131707174 GAGTGGCCAAGCCCAGCATGTGG - Intergenic
1050083850 9:1943298-1943320 TAATTGCCAATGCCAGGATTTGG + Intergenic
1054784802 9:69200422-69200444 GTATTGCCAAGGCTGGAGTGTGG + Intronic
1054949891 9:70838292-70838314 AAATTTCCAAGGCGATAATGAGG + Intronic
1055286075 9:74729424-74729446 GATGTGCCAAGCTCAGAATGAGG + Intronic
1055530599 9:77178771-77178793 GAATTTCCCAGGCCAAAGTGAGG + Intronic
1056150314 9:83781028-83781050 GAATTATCAAGAGCAGAATGAGG + Intronic
1056885319 9:90437087-90437109 GAATTAACAAAGCCAGACTGTGG - Intergenic
1062688655 9:137829286-137829308 GAATTGCAAAGGCAAGAAAAAGG - Intronic
1186164122 X:6808587-6808609 GAATTACCATGGTCAGAATAAGG + Intergenic
1190982503 X:55468436-55468458 TAATTGCCATGAACAGAATGTGG + Intergenic
1190986196 X:55504747-55504769 TAATTGCCATGAACAGAATGTGG - Intergenic
1191139902 X:57105680-57105702 TAATTGCAAGGGCCAGGATGGGG - Intergenic
1192484723 X:71515155-71515177 CAATTGCCCAAGCCAGGATGAGG + Intronic
1195842146 X:109185801-109185823 GAATTACCATGGCCATTATGTGG - Intergenic
1196052627 X:111321640-111321662 GAGTGGCCAAGGACAGAGTGGGG + Intronic
1196690091 X:118549904-118549926 GAAATGCAAAGGCCATATTGAGG + Intronic
1197133986 X:123039450-123039472 GAATTTCCAAGTGCAGGATGAGG - Intergenic
1198873153 X:141196787-141196809 TAATTGCAAGGGCCAGGATGGGG + Intergenic
1199972765 X:152872900-152872922 GACATGCCAAGGGCAGAGTGGGG + Intergenic
1201986568 Y:19975080-19975102 GAAATTCCAAGGGCAGAATTTGG - Intergenic