ID: 1067799283

View in Genome Browser
Species Human (GRCh38)
Location 10:49347932-49347954
Sequence CAGTGAGGGCCTGTGGCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067799283_1067799290 24 Left 1067799283 10:49347932-49347954 CCTTTGGCCACAGGCCCTCACTG No data
Right 1067799290 10:49347979-49348001 GATGGCCCTGAGAGCCTAGCAGG No data
1067799283_1067799288 6 Left 1067799283 10:49347932-49347954 CCTTTGGCCACAGGCCCTCACTG No data
Right 1067799288 10:49347961-49347983 AGAGGCTTATTGTCCAGTGATGG No data
1067799283_1067799291 25 Left 1067799283 10:49347932-49347954 CCTTTGGCCACAGGCCCTCACTG No data
Right 1067799291 10:49347980-49348002 ATGGCCCTGAGAGCCTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067799283 Original CRISPR CAGTGAGGGCCTGTGGCCAA AGG (reversed) Intergenic
No off target data available for this crispr