ID: 1067802636

View in Genome Browser
Species Human (GRCh38)
Location 10:49369660-49369682
Sequence TTGGCTGCACAACAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067802632_1067802636 19 Left 1067802632 10:49369618-49369640 CCGGTCAGAGCTTCGGTTTTGCA 0: 1
1: 0
2: 1
3: 4
4: 76
Right 1067802636 10:49369660-49369682 TTGGCTGCACAACAGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067802636 Original CRISPR TTGGCTGCACAACAGCAGGA AGG Intronic
No off target data available for this crispr