ID: 1067805018

View in Genome Browser
Species Human (GRCh38)
Location 10:49386339-49386361
Sequence GCCTCCTGTCAGTCACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 228}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067805018_1067805023 10 Left 1067805018 10:49386339-49386361 CCTGGCTGTGACTGACAGGAGGC 0: 1
1: 0
2: 1
3: 16
4: 228
Right 1067805023 10:49386372-49386394 CACAGGCCCAGGTGCAAGGACGG 0: 1
1: 0
2: 4
3: 38
4: 407
1067805018_1067805021 -1 Left 1067805018 10:49386339-49386361 CCTGGCTGTGACTGACAGGAGGC 0: 1
1: 0
2: 1
3: 16
4: 228
Right 1067805021 10:49386361-49386383 CGAGGAAGCTGCACAGGCCCAGG 0: 1
1: 0
2: 0
3: 26
4: 251
1067805018_1067805020 -7 Left 1067805018 10:49386339-49386361 CCTGGCTGTGACTGACAGGAGGC 0: 1
1: 0
2: 1
3: 16
4: 228
Right 1067805020 10:49386355-49386377 AGGAGGCGAGGAAGCTGCACAGG 0: 1
1: 0
2: 2
3: 29
4: 306
1067805018_1067805026 27 Left 1067805018 10:49386339-49386361 CCTGGCTGTGACTGACAGGAGGC 0: 1
1: 0
2: 1
3: 16
4: 228
Right 1067805026 10:49386389-49386411 GGACGGCCGAGCCAAGACCCAGG 0: 1
1: 0
2: 0
3: 5
4: 93
1067805018_1067805022 6 Left 1067805018 10:49386339-49386361 CCTGGCTGTGACTGACAGGAGGC 0: 1
1: 0
2: 1
3: 16
4: 228
Right 1067805022 10:49386368-49386390 GCTGCACAGGCCCAGGTGCAAGG 0: 1
1: 0
2: 1
3: 41
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067805018 Original CRISPR GCCTCCTGTCAGTCACAGCC AGG (reversed) Intronic
900318620 1:2071346-2071368 GCCTCCTCTCAGACGCCGCCGGG - Intronic
900362131 1:2294220-2294242 AGCTGCTGTGAGTCACAGCCAGG + Intronic
900407003 1:2497168-2497190 GCCTGGTGTCAGTGGCAGCCTGG - Intronic
900482815 1:2907585-2907607 GGCACCTGTCAGTTACAGGCTGG + Intergenic
901611792 1:10504565-10504587 GCCTCTTGGCAGACACAGCTGGG - Intronic
901848579 1:12000483-12000505 GCCTAGTGTCAGTCACAAGCGGG - Intronic
902731577 1:18373400-18373422 GCCTCCTGACACTCCGAGCCTGG - Intronic
902979477 1:20112871-20112893 GCCACCTGTCACTCATGGCCAGG - Exonic
903712267 1:25334799-25334821 GCCTCCTGTCAGTCATGGTTGGG + Intronic
904303298 1:29570165-29570187 GACACCTGTCAGGCACAGCCAGG - Intergenic
905337841 1:37257662-37257684 GCCTCCAGACAGGCACAGGCTGG - Intergenic
906475063 1:46164034-46164056 ACCTCCAGTGAGCCACAGCCAGG + Intronic
907527085 1:55059998-55060020 CCCTCCTTTCAGCCCCAGCCGGG - Intronic
910740830 1:90514464-90514486 TCCTGCTCTCAGTCACAACCAGG + Intergenic
916245995 1:162688846-162688868 GGCACCTGCCAGTCACAGCTTGG + Intronic
917431781 1:174976897-174976919 TACCCCTGTCAGTCCCAGCCAGG + Intronic
917700745 1:177578371-177578393 CCCTCCAATCAGTCACATCCAGG + Intergenic
919386334 1:196927575-196927597 AACTCCTAACAGTCACAGCCTGG + Intronic
1063296809 10:4815029-4815051 GGCTTCTGTGAGTCACTGCCTGG + Intronic
1063656588 10:7996455-7996477 GCCTCCTGGCATTCACACACTGG - Intronic
1066457595 10:35585470-35585492 GCTTCCTGCCCATCACAGCCTGG + Intergenic
1067805018 10:49386339-49386361 GCCTCCTGTCAGTCACAGCCAGG - Intronic
1069842393 10:71347964-71347986 GCCTCCTCACAGACACGGCCAGG - Intronic
1070309339 10:75261975-75261997 GCCTCCAGGCAGCCAGAGCCCGG + Intergenic
1072321154 10:94251614-94251636 GCATCCTGTAAGTAACAGCAGGG - Intronic
1073466260 10:103696152-103696174 CCCACCATTCAGTCACAGCCTGG - Intronic
1074833720 10:117268675-117268697 ACCTCCTGCCAGTCACACCTGGG + Intronic
1075648528 10:124112310-124112332 GCCTCCTCTCAGCCCCATCCAGG + Intergenic
1075660007 10:124186880-124186902 GCCTCCTGGTAGTAACACCCTGG + Intergenic
1075827343 10:125370598-125370620 GTCTCCTGTGAGGCACACCCGGG - Intergenic
1077703589 11:4463254-4463276 ACCTCCTGTCTCTCACAGCAGGG + Intergenic
1077889271 11:6406899-6406921 ACCTCCTGGCCTTCACAGCCTGG - Intronic
1078267259 11:9764635-9764657 GCCTCCTGTCCATGACAGCCTGG + Intergenic
1078576788 11:12509560-12509582 GACTCCTGTCAGTCATGGCTGGG - Intronic
1079037800 11:17036083-17036105 GACCCCTGGCAGCCACAGCCTGG + Intergenic
1079329317 11:19520816-19520838 GCCTCCTGTGAGTGCCAGCTTGG - Intronic
1081842973 11:46216875-46216897 GCCTCCTGACGTTCACACCCTGG + Intergenic
1082101146 11:48174122-48174144 GCCCCCTTTCAGCCACACCCTGG + Intergenic
1084383506 11:68828369-68828391 GCCACCTGTCCGCTACAGCCAGG + Intronic
1085525496 11:77161307-77161329 GCCTCCTGACAACCCCAGCCAGG - Intronic
1089456363 11:118628140-118628162 GCCTCCTGAGAGTCCCCGCCTGG + Exonic
1090483170 11:127086035-127086057 TCCTGCTGTCAGTCCCAGTCTGG - Intergenic
1091794754 12:3291688-3291710 GCCTCATGTCAGCCCCAGCTGGG - Intergenic
1098137701 12:67420117-67420139 GCCTCCTGTATGTAACATCCTGG - Intergenic
1101831869 12:108264055-108264077 GGCTCCTGCCAGTCTCAGCTTGG - Intergenic
1102043523 12:109815703-109815725 GCCTCCTGGCACCCACAGCCTGG - Intronic
1102825466 12:115944606-115944628 GACTCCAGTCAGTCACTACCAGG + Intergenic
1102955999 12:117059342-117059364 GCCTCCTGTCCCTCCCACCCAGG + Intronic
1103971868 12:124677622-124677644 GCCCCCTGTAAGTCAGAACCAGG + Intergenic
1103997946 12:124842189-124842211 GCCCCGTGTCACTCCCAGCCAGG + Intronic
1104047459 12:125173354-125173376 GTCTGCCGTCAGTCACACCCTGG - Intergenic
1104555636 12:129797578-129797600 CTCTCATGTAAGTCACAGCCGGG - Intronic
1105428220 13:20313958-20313980 GTCTTCTGCCAGTCACAGCCAGG + Intergenic
1105780560 13:23702191-23702213 GCGTCCTGACAGTGACAGTCTGG - Intergenic
1107014246 13:35695848-35695870 GCCTCCTGGAATTCACACCCTGG - Intergenic
1107443502 13:40449296-40449318 GCCTCTTGCCATTTACAGCCTGG + Intergenic
1108527301 13:51296804-51296826 GCTTCCTGTCACTCACAATCAGG + Intergenic
1109933123 13:69243562-69243584 GCCAGGTGGCAGTCACAGCCTGG + Intergenic
1110354640 13:74553071-74553093 GCCTCCTGATAGACACAGCCGGG - Intergenic
1112608294 13:100929683-100929705 GCCTGCTTTCAGTCTCTGCCAGG - Intergenic
1121661215 14:95636592-95636614 TCCCCCTGTCAGCCTCAGCCTGG + Intergenic
1121788688 14:96682419-96682441 GCCTCCTGTGAGCCTCAGCCAGG + Intergenic
1122152984 14:99734621-99734643 GCCTGCTGTCTGGCACACCCAGG - Intergenic
1122976224 14:105171912-105171934 TCCTCCTGGGAGCCACAGCCTGG + Intergenic
1123936097 15:25194796-25194818 GCCTGCTGTATGGCACAGCCAGG + Intergenic
1124348272 15:28936835-28936857 GTCTCCTGTCTGTCCCAGCAGGG - Intronic
1125597834 15:40899028-40899050 GTCTCTGGTCAGTCACTGCCTGG + Intronic
1127350620 15:58148497-58148519 GCCTCTTGTCACTCTCAACCTGG - Intronic
1128984834 15:72211969-72211991 GCCTCCTGTGAATAACAGGCAGG - Intronic
1129153823 15:73705145-73705167 GCCTCTGGTCAGTCACTTCCTGG + Intronic
1129674753 15:77626516-77626538 GCCTCCAGTCAGACACATACAGG + Intronic
1130550698 15:84888500-84888522 GGCCCCTCTCAGTCACAGCTGGG + Intronic
1130777320 15:86998460-86998482 GCCTCATGTAAGTCTCAGCTGGG - Intronic
1132854154 16:2037353-2037375 GCCACCTGCCTGTCACTGCCAGG + Intronic
1132897173 16:2234553-2234575 GACACCTGTCAGTGCCAGCCTGG - Intronic
1134097872 16:11431064-11431086 GCCTCCTGACACTCACAGGAAGG - Exonic
1134353463 16:13459681-13459703 GCCTCCTGTTAGCAAGAGCCAGG - Intergenic
1135510133 16:23075387-23075409 GCCTCTTCTCAGTCACAGTGTGG + Intronic
1136395033 16:29987897-29987919 GCCTCCCGCCAGCCACTGCCAGG + Exonic
1137701962 16:50503775-50503797 GTGTCCTGTCAGTCACAGGATGG - Intergenic
1138384945 16:56629893-56629915 GCCTCCTGGCAGGGTCAGCCTGG - Intergenic
1140146917 16:72320083-72320105 GGCCCCTTTCAGCCACAGCCTGG + Intergenic
1141997712 16:87645803-87645825 GGCTCCTGCCAGCCACAGCTTGG - Intronic
1143783323 17:9240524-9240546 GCCACCTGGCTGTCACAGCCTGG + Exonic
1144346536 17:14354668-14354690 GCCTCCTGGCATTCACACCCTGG + Intergenic
1144638710 17:16926253-16926275 GCCCCCTCTCAGGCAGAGCCTGG + Intergenic
1144727142 17:17507619-17507641 CCCACCTGTCCCTCACAGCCAGG + Intronic
1144777091 17:17790254-17790276 GCCGCCTCTCAGTGCCAGCCAGG - Intronic
1146314157 17:31794316-31794338 GCCACCTGTCAGAGACACCCAGG + Intergenic
1148151939 17:45402243-45402265 GCCTCCTGTCTCTCTCAGGCTGG + Intronic
1149345591 17:55731926-55731948 ACGTCATGTCAGTCACAGCAGGG - Exonic
1150383760 17:64741221-64741243 GCCTCATTTCAATAACAGCCGGG + Intergenic
1150410560 17:64937695-64937717 GCCTCCTGTCTCTCTCAGGCTGG - Intergenic
1150699205 17:67433193-67433215 GTCTCCTGGCAGTCAGTGCCAGG + Intronic
1150703481 17:67467700-67467722 GCCACCTGCCAGCCACAACCAGG + Intronic
1151338816 17:73456728-73456750 ACCTCCTGGCAGGCAGAGCCAGG - Intronic
1152684697 17:81688291-81688313 CCCTCCTTCCAGTCACAGCCGGG - Intronic
1153960496 18:10136052-10136074 TCCTCCAGTCAGTCACGTCCCGG - Intergenic
1155035229 18:22020292-22020314 GACTCCTCTCAGTCCCAGGCAGG - Intergenic
1155353767 18:24931170-24931192 GCTTCCCGGCTGTCACAGCCTGG + Intergenic
1155942365 18:31812119-31812141 GACTCCTGGGAGTGACAGCCAGG + Intergenic
1158691499 18:59665348-59665370 GCCTCCAGTGATTAACAGCCAGG + Intronic
1160116658 18:76085123-76085145 GCCCCTTGTCAGGAACAGCCTGG - Intergenic
1160213764 18:76907859-76907881 ACCTACTGTCTCTCACAGCCTGG - Intronic
1161949436 19:7459662-7459684 TCCTCCTCTAAGTCACAGGCAGG + Intronic
1163747450 19:19056795-19056817 GCCCCCTGTGGGTCCCAGCCTGG - Intronic
1164463358 19:28466896-28466918 GCCGCCTGTGTGTCAGAGCCCGG - Intergenic
1164754591 19:30680130-30680152 GCCTCCTCTCTGTCACACCGGGG + Intronic
1164817804 19:31218968-31218990 ACCTCCTGACAGTCACAGTGTGG - Intergenic
1165181848 19:33978528-33978550 CCCACATGACAGTCACAGCCAGG + Intergenic
1166283495 19:41810076-41810098 CGCTCCTGCCAGTCACTGCCAGG + Intronic
1166496538 19:43306914-43306936 ACCACCTCTCAGTCACAGCGTGG + Intergenic
1166778302 19:45325792-45325814 GCCTCCTGTCAGTCTCACAGTGG - Intergenic
1167593505 19:50416368-50416390 GCCACATGGCAGTCACACCCGGG - Intronic
1167668533 19:50836726-50836748 GCCTCCTGTCGGTCACCACGTGG + Intronic
1168063340 19:53906436-53906458 GCCTCCTTTCAGACCCCGCCCGG + Exonic
1168670431 19:58237495-58237517 GCCTAGTGTTAGGCACAGCCTGG + Intronic
928039782 2:27863311-27863333 GCCTCCTGCCTGGCACACCCAGG - Intronic
928241572 2:29591383-29591405 GCATCCGGGCAGCCACAGCCAGG + Intronic
929302952 2:40326757-40326779 GACTCCTTTCAGTCACTTCCAGG + Intronic
929420890 2:41788546-41788568 GCCTCCTGGAAGAGACAGCCAGG + Intergenic
930619942 2:53633214-53633236 GGGTCCTGCCAGTCACAGCAGGG - Intronic
932278583 2:70470363-70470385 GCCTCCTGGCAGTCTTAGCAAGG + Intronic
932480836 2:72038145-72038167 GACTCCTGGCAGTATCAGCCAGG + Intergenic
934557198 2:95293762-95293784 GCCTCCTGTGAGAGACAGCATGG + Intergenic
935794550 2:106628696-106628718 GCCTCCTGTCAGCCTCAAACAGG + Intergenic
936389181 2:112055889-112055911 GCCTTTTGTCTGTTACAGCCGGG + Intronic
937258542 2:120571195-120571217 GCATCCTGCCAGGCACTGCCAGG - Intergenic
938065920 2:128281986-128282008 CTCTTCAGTCAGTCACAGCCTGG - Intronic
938288578 2:130137676-130137698 ACCTCCAGGCAGCCACAGCCTGG + Intergenic
938288608 2:130137819-130137841 GCCTCCTGTCAGACACTTCTAGG + Intergenic
938426981 2:131201068-131201090 GCCTCCTGTCAGACACTTCTAGG - Intronic
938467925 2:131535113-131535135 GCCTCCTGTCAGACACTTCTAGG - Intergenic
938467954 2:131535258-131535280 ACCTCCAGGCAGCCACAGCCTGG - Intergenic
938746232 2:134280997-134281019 GCTACTTGGCAGTCACAGCCTGG + Intronic
940266560 2:151844999-151845021 GGGTCCTGACATTCACAGCCAGG + Intronic
942249109 2:174032777-174032799 GCCTCTTCACAGCCACAGCCAGG + Intergenic
942571171 2:177315941-177315963 TCCTCCTGTCAATCACAGGTAGG + Intronic
945976293 2:216273787-216273809 TCCTTCTGGCAGTCCCAGCCAGG + Intronic
946406032 2:219492576-219492598 GGCTCCTGCCAGGCAGAGCCAGG - Exonic
948004635 2:234597139-234597161 GCCCCCTTTCAGTCAGATCCGGG - Intergenic
1169288397 20:4328484-4328506 GCTTTCCATCAGTCACAGCCTGG - Intergenic
1172930079 20:38580165-38580187 ACCTGCTGGCAGTCACAGGCAGG + Intergenic
1173403365 20:42744119-42744141 TCCTCCTGTCAGGCAGGGCCTGG - Intronic
1174055499 20:47795437-47795459 GTCTTCTGTCCGTCACAGCCTGG + Intergenic
1175171605 20:57085050-57085072 GCCACCTGACAGTCACAGGGCGG + Intergenic
1176874866 21:14117481-14117503 GCCTGATTTCAGTCCCAGCCTGG - Intronic
1177766572 21:25464743-25464765 TCCTCCTGTCAGTCTCACTCTGG - Intergenic
1178533771 21:33396127-33396149 CCCTTCTGTAAGCCACAGCCAGG - Intergenic
1179185189 21:39080461-39080483 TCTTGCTGTCAGTTACAGCCAGG + Intergenic
1179780288 21:43695439-43695461 GCACCCTGTCACTCCCAGCCGGG - Exonic
1180794037 22:18593186-18593208 TCCTCCTGTCACTGACGGCCTGG - Intergenic
1181051390 22:20239815-20239837 GGCTCCTTGCAGTCAGAGCCAGG - Intergenic
1181108160 22:20586753-20586775 GCCTCCTGTCAGACACTTCTAGG + Exonic
1181227702 22:21402134-21402156 TCCTCCTGTCACTGACGGCCTGG + Intergenic
1181250949 22:21532705-21532727 TCCTCCTGTCACTGACGGCCTGG - Intergenic
1181275534 22:21685434-21685456 TCCTCCTGTCAGGCAGAGCATGG + Intronic
1181518340 22:23430891-23430913 GCTTCCTGGCAGTCACACCCTGG - Intergenic
1182668193 22:31973957-31973979 CACTCCTGTCACTCACTGCCTGG - Intergenic
1183357827 22:37368911-37368933 TCCTCTTGTCATTCACAGCTTGG + Exonic
1184445642 22:44545318-44545340 GCCTGCGCTCAGTCACAGCGAGG - Intergenic
953239721 3:41137979-41138001 GCCACATGTCAATCACAGACAGG - Intergenic
954326108 3:49864954-49864976 GACTCCTGGGAATCACAGCCTGG - Intronic
956274540 3:67483934-67483956 GCCTCCTGTAAGCCAAAGCTTGG - Intronic
959498323 3:107076620-107076642 GCCTTATTTCAGGCACAGCCTGG - Intergenic
959826071 3:110797241-110797263 GTCTCTTGTCAGTGGCAGCCAGG + Intergenic
961803303 3:129469360-129469382 GTCCCCAGTCAGCCACAGCCAGG - Exonic
962862954 3:139421543-139421565 ACATGCTGTCAGCCACAGCCAGG - Intergenic
966847953 3:184145043-184145065 TGCTCCTTTCAGTCTCAGCCTGG - Exonic
967174054 3:186846613-186846635 GCCTCCTGCCAGTCCCAGAGGGG + Intronic
968124045 3:196145387-196145409 TGCGCCTGTCAGTCAGAGCCAGG - Intergenic
968124050 3:196145420-196145442 TGCGCCTGTCAGTCAGAGCCAGG - Intergenic
968124055 3:196145453-196145475 TGCGCCTGTCAGTCAGAGCCAGG - Intergenic
968124060 3:196145486-196145508 TGCGCCTGTCAGTCAGAGCCAGG - Intergenic
968124074 3:196145585-196145607 TGCGCCTGTCAGTCAGAGCCAGG - Intergenic
968706651 4:2081461-2081483 GCCTCCTGACAGTAACTGCCAGG + Intronic
969538124 4:7769174-7769196 GTCTCCTGGCATTCACGGCCGGG + Intronic
969576463 4:8038895-8038917 GCTCCCAGTCACTCACAGCCTGG + Intronic
969639404 4:8388037-8388059 ACCTCCCGTCATTCACAGCAGGG + Intronic
970191999 4:13526088-13526110 GCCTTGCATCAGTCACAGCCTGG - Intergenic
971379184 4:26081301-26081323 GCCCCCGATCTGTCACAGCCAGG + Intergenic
973531716 4:51842897-51842919 GGCTGCTGTCAGTCACCCCCAGG - Intergenic
981021839 4:140037563-140037585 GCCTCCTGTGAGTCACATTGTGG - Intronic
985236499 4:187880953-187880975 GCCTCCTGGTATTCACACCCTGG - Intergenic
985829163 5:2215335-2215357 GCCTCCTGGGATTCACAGCAGGG - Intergenic
989471309 5:41822231-41822253 GCCTCCTGTCACTCCCAGTAGGG - Intronic
990371489 5:55123582-55123604 GCCTCCTGGCAGTCAGCACCTGG - Intronic
993092350 5:83441920-83441942 GCCTCCAGTCACTCACCACCTGG + Intergenic
994543882 5:101137547-101137569 GCCACATTTCAGTCACTGCCTGG + Intergenic
995841420 5:116446750-116446772 GCCTCGAGACAGTCACGGCCTGG + Exonic
997977138 5:138447062-138447084 AGCTCCTGTCAGTCACAGGCTGG - Intergenic
1000195022 5:158948730-158948752 GCCACATGTCAGTCAAAGGCAGG - Intronic
1000947529 5:167439752-167439774 TCCTCCTCTCAGACAAAGCCAGG + Intronic
1001522248 5:172403058-172403080 ACCTCATGTCAGGCACAGGCCGG - Intronic
1002490393 5:179572159-179572181 GCTTCCAGTCAGTCGCAGCTCGG + Intronic
1005781905 6:29201458-29201480 GCCTCTTGGCAGGAACAGCCTGG + Intergenic
1006933480 6:37701403-37701425 GCCTCCGGCGAGTGACAGCCTGG + Intergenic
1008045647 6:46849102-46849124 GCCTCCTCTCAGGCCCAGCAGGG + Intergenic
1013709642 6:112881300-112881322 GCCGCCTGTCAGTCACACCCTGG - Intergenic
1015334591 6:132022666-132022688 ACCACCTGACAATCACAGCCTGG - Intergenic
1016597019 6:145814587-145814609 GCCTCCCGTCACTCACCGGCCGG + Exonic
1016776549 6:147910624-147910646 GGCTCCTCTCATTCGCAGCCTGG - Intergenic
1017823692 6:158066432-158066454 GCCTCCTGACAGTGACTCCCAGG + Exonic
1018726553 6:166617019-166617041 ACCTTCTGTCAGGCAGAGCCGGG - Intronic
1018798785 6:167207150-167207172 CCTTCCAGTCAGTGACAGCCAGG - Intergenic
1018808290 6:167278116-167278138 GGGTCCTGTCAGGCACAGACAGG + Intronic
1019271901 7:154190-154212 GCCTCCTGCCAGTCCCTGCCAGG + Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1020124925 7:5528241-5528263 CCCTCATGTCAGGCAGAGCCGGG + Intronic
1022382824 7:29875984-29876006 GCCTCCTGTGAGCCAAAGACAGG + Intronic
1022740449 7:33114883-33114905 TCTTCCTGTCAGTCTCAGCTGGG + Intergenic
1023939623 7:44761308-44761330 CCCTCCTGTCAGGCACTGCTTGG - Intronic
1024109854 7:46134087-46134109 GGGTCCTGTCAGTCACAGTAGGG - Intergenic
1025237486 7:57244694-57244716 GTCTCCTGTCCATCACATCCTGG - Intergenic
1027641386 7:80737651-80737673 GCCTCCTGTCAGTTCTATCCTGG - Intergenic
1027815205 7:82959702-82959724 TCCTCCTCTCACTCACTGCCTGG + Intronic
1030421291 7:109309809-109309831 GCCTCTTCTGAGCCACAGCCTGG + Intergenic
1034277056 7:149828638-149828660 GCCTCCTGCCATTCAGATCCAGG - Intergenic
1034546572 7:151793582-151793604 GCCTGCCCTCAGTCACTGCCCGG + Intronic
1035624730 8:1062323-1062345 GGCTCCAGTCAGCCACAGCCCGG - Intergenic
1036918109 8:12824613-12824635 GCCTCCTGTCTGTCACTCTCCGG + Intergenic
1038268233 8:26052202-26052224 GCCTCCAGTCAGCCACCTCCTGG - Intergenic
1042567805 8:70130078-70130100 GGCTCCTGGCTGTCACAGGCTGG - Intronic
1043978750 8:86614320-86614342 ACTACCTGTCAGTCACAGCAAGG + Intronic
1045322531 8:101092596-101092618 CCTTCCTGTGATTCACAGCCAGG - Intergenic
1047782469 8:128121192-128121214 GCCACCATTGAGTCACAGCCTGG + Intergenic
1048369807 8:133767435-133767457 GCCTCCACGCAATCACAGCCTGG - Intergenic
1048373946 8:133805376-133805398 GGCTCCTGGCTGTCCCAGCCAGG - Intergenic
1048569720 8:135641735-135641757 GCCAGCTGTCAGTCAAGGCCTGG - Intronic
1049045898 8:140151259-140151281 GCCTGCTGTGAGTCTGAGCCCGG - Intronic
1049372814 8:142275832-142275854 GACTGCTGCCAGGCACAGCCTGG + Intronic
1050191119 9:3027471-3027493 TCCTGCTGCCAGTCTCAGCCAGG + Intergenic
1055715755 9:79116150-79116172 GCCTCCTCTCATTCACAGTCTGG + Intergenic
1056017661 9:82407777-82407799 TCATCCTGGCAATCACAGCCTGG - Intergenic
1057029253 9:91761417-91761439 GTCTCCTGTCACTCCCAGACGGG - Intronic
1057605112 9:96493418-96493440 GCCCCCTGTGGGACACAGCCAGG - Intronic
1058270678 9:102968099-102968121 GCCTCTTGGCAGGAACAGCCTGG - Intergenic
1059676840 9:116548189-116548211 GCCTCCTGACTGCCAGAGCCTGG - Intronic
1060043806 9:120324591-120324613 GCCTCCTGCCCCTCACAGCTAGG - Intergenic
1061653099 9:132066912-132066934 GCCTCCTGGCACTCACTCCCAGG + Intronic
1061665975 9:132161406-132161428 GGCTCCGGTCAGGCGCAGCCGGG - Intergenic
1062457397 9:136646132-136646154 GCCCCTTGTCAGCCAGAGCCTGG + Intergenic
1195228061 X:102818389-102818411 GGCTCCTTTCAGCCACAGCTGGG + Intergenic
1197578809 X:128256207-128256229 GGCTCCTTTTAGTCACAGCTGGG + Intergenic
1199892386 X:152099119-152099141 GCCTCCTGTATCTCCCAGCCTGG + Intergenic
1199978993 X:152910884-152910906 CCCTCCACTCAGTGACAGCCAGG - Intergenic