ID: 1067806017

View in Genome Browser
Species Human (GRCh38)
Location 10:49394494-49394516
Sequence CAGTCTCAGCACTGGGGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067806017_1067806021 -8 Left 1067806017 10:49394494-49394516 CCAATACCCCAGTGCTGAGACTG 0: 1
1: 0
2: 1
3: 10
4: 174
Right 1067806021 10:49394509-49394531 TGAGACTGCTGCTCTGCAGAAGG No data
1067806017_1067806026 21 Left 1067806017 10:49394494-49394516 CCAATACCCCAGTGCTGAGACTG 0: 1
1: 0
2: 1
3: 10
4: 174
Right 1067806026 10:49394538-49394560 TAAAGCCCACAGTGTGGCATTGG No data
1067806017_1067806023 15 Left 1067806017 10:49394494-49394516 CCAATACCCCAGTGCTGAGACTG 0: 1
1: 0
2: 1
3: 10
4: 174
Right 1067806023 10:49394532-49394554 CCCCATTAAAGCCCACAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067806017 Original CRISPR CAGTCTCAGCACTGGGGTAT TGG (reversed) Intronic
900549436 1:3246750-3246772 CAGTCTGAGCCCTGGGGTTAGGG - Intronic
902096474 1:13950067-13950089 CAGGCTCAGCCCTGGGGTGTGGG - Intergenic
902857524 1:19219723-19219745 CAGTCTGAGCACTGCTGTAAAGG + Intronic
906088343 1:43155732-43155754 CAGTCTCAGTACTGGGACACTGG + Intronic
906977928 1:50595378-50595400 GACTCTCAGCACTTTGGTATAGG + Intronic
908962671 1:69718280-69718302 CAGTCTCAGGAATGTGGTAGAGG + Intronic
909066981 1:70947033-70947055 CAGCCTCAGCACTGTGTTCTTGG + Intronic
912435004 1:109655686-109655708 CAGTCTCAGAGCTGGGGAACTGG + Intergenic
914260329 1:145993746-145993768 CAGTCTCTGCAATGGAGTGTGGG - Exonic
915107212 1:153542070-153542092 AAGGCCCAGCACTGGGGTAGAGG + Intergenic
916380634 1:164207069-164207091 CACTCTCAGCCCTTGGCTATAGG - Intergenic
917350755 1:174075318-174075340 AAGTCTCAACACGGGGCTATAGG - Intergenic
920166133 1:204037301-204037323 CAGTCTCGGGGCGGGGGTATGGG + Intergenic
922688733 1:227669735-227669757 CATTCTCACCAACGGGGTATGGG - Intronic
923523991 1:234758517-234758539 TAGTATCAGCACTGGGGTGAGGG - Intergenic
923545709 1:234921831-234921853 CAGTCACAGCTCTGGGCTTTGGG - Intergenic
924596826 1:245453498-245453520 TAGTCCCAGCCCTGGGGTAAAGG + Intronic
1062932071 10:1360161-1360183 CAGTCTCTGCACTTGGGTGCCGG - Intronic
1067152536 10:43748716-43748738 CAGTCTCAGCCCTGGTTTCTAGG + Intergenic
1067806017 10:49394494-49394516 CAGTCTCAGCACTGGGGTATTGG - Intronic
1075241117 10:120779942-120779964 CAGTCTCAAAAGTGGGTTATTGG - Intergenic
1077511116 11:2963660-2963682 CCATCTCAGCACTGGGGCCTGGG - Intronic
1078961015 11:16270857-16270879 GAGTTTCAGGACTGGGGAATGGG + Intronic
1079196201 11:18329396-18329418 AAGGCTCAGAAATGGGGTATGGG + Intronic
1081503292 11:43688330-43688352 AAGTCTGATCACTGTGGTATGGG + Intronic
1081838473 11:46177173-46177195 CAGTCTCAGAAATGGGATTTGGG + Intergenic
1084377445 11:68787493-68787515 CAGCCTGTGCCCTGGGGTATAGG - Intronic
1085204191 11:74720756-74720778 CCCTCTCAGCACTGGGGGCTGGG + Intronic
1086142957 11:83519115-83519137 CAGTCTCAGTACTAGGGGCTGGG + Intronic
1099444406 12:82735065-82735087 GAGTCTCAGCCCTGTGGTTTAGG - Intronic
1103532341 12:121611339-121611361 CAGGCCCAACACTGGGGTGTGGG - Intergenic
1103808892 12:123597652-123597674 CAGTGTCAGCATTAGGGTTTTGG + Exonic
1104262511 12:127197394-127197416 CAGTCACAGTCCTGGGGTCTGGG + Intergenic
1104439691 12:128784805-128784827 CCATCTCAGCCCTGGGGCATAGG + Intergenic
1105063199 12:133172815-133172837 CAGTCTCAGCACTGCAGCCTTGG - Intronic
1107020545 13:35746602-35746624 CACTCTGAGCATTTGGGTATAGG + Intergenic
1108826139 13:54415110-54415132 CAGTCTCAGGCCTGGTGTTTGGG - Intergenic
1112630519 13:101156820-101156842 CAGTCTTAACATTGGGGTCTTGG + Intronic
1115037040 14:28870503-28870525 CAGTCCCAGCACTGTATTATGGG + Intergenic
1116098419 14:40403103-40403125 CAGTGTCAGCACTGGGTTGAAGG - Intergenic
1116969867 14:51052832-51052854 CAGTGGCAGCAATGAGGTATGGG - Intronic
1117615405 14:57529016-57529038 AAGTCTCAGCCCTGGGCTATAGG + Intergenic
1119740860 14:77012924-77012946 GACTCTCAGCACTGGGGGACGGG - Intergenic
1121498090 14:94411473-94411495 CTGACTCAGTCCTGGGGTATTGG - Intergenic
1121505402 14:94473223-94473245 CAGCCTCAGAACTGGGGTGGTGG + Intronic
1121972601 14:98372255-98372277 AAGTCTCTGTATTGGGGTATAGG - Intergenic
1122705368 14:103617468-103617490 GAGTCTCAGCACTGTGGTGCTGG - Intronic
1125333598 15:38606016-38606038 CAGTCTGAGGACTGGGGTCCCGG - Intergenic
1131175974 15:90210067-90210089 CAGGCTCAGGACTGCGGTAGTGG + Intronic
1133405424 16:5520536-5520558 CAGTCTCAGCAGAAGGATATAGG - Intergenic
1136089315 16:27906989-27907011 CATTCTCAGCACTTGAGTATGGG + Intronic
1139576658 16:67846606-67846628 CAGTCTGTGCACTGGGGTGGGGG - Intronic
1141177345 16:81729768-81729790 AAGTCTCAGCACTAGGGCAGTGG + Intergenic
1141571090 16:84934045-84934067 CAGAGTCAGCACTGGGATACCGG - Intergenic
1142555547 17:774277-774299 CAGACTCAGCATGGGGGCATCGG + Intronic
1144203107 17:12958914-12958936 CTTTCTCAGCACTGGGGATTAGG + Intronic
1145965082 17:28911292-28911314 CTGTCTCAGCAGTGGGGGATTGG - Intronic
1146619357 17:34385611-34385633 CAGGGTCAGGACTGGGGTTTGGG - Intergenic
1146673258 17:34756467-34756489 CAGGCTCAGCACTGGGGGGTGGG - Intergenic
1147815009 17:43203211-43203233 CACTCTTAGCACTGGGGAAAAGG + Intronic
1148816341 17:50330677-50330699 TATTCTAAGCACTGGGATATAGG - Intergenic
1151280879 17:73073233-73073255 CACTCTCATAATTGGGGTATTGG - Intronic
1152371171 17:79889441-79889463 CAGTAGCAGCAATGGGGCATGGG - Intergenic
1152676201 17:81642558-81642580 CAATCTCAGCATTGAGGTGTGGG - Intronic
1153995690 18:10439765-10439787 CAGGCTCAGGCCTGGGCTATTGG - Intergenic
1154217924 18:12429063-12429085 CAGCCTCAGCGCTGGGATTTGGG + Intronic
1157940734 18:51926438-51926460 CAGTCACAGTACTGGGCCATGGG - Intergenic
1160807935 19:1000805-1000827 CAGGCTGAGCACGGGGGTCTCGG - Exonic
1161039828 19:2104323-2104345 CGGTCTCGGCATTGGGGTCTGGG - Intronic
1162783291 19:13018404-13018426 TAGACCCAGCACTGGGGTGTGGG + Intronic
1164618151 19:29678790-29678812 CAGGCTCAGCTCTGGGGAAAGGG - Intergenic
1166293461 19:41877801-41877823 CCTTCTCAGCACTGGGGGAATGG + Intronic
1166584726 19:43935463-43935485 CCCACTGAGCACTGGGGTATAGG + Intergenic
1168281239 19:55306472-55306494 CAGTCCCAGCACTGGGCTGCAGG - Intronic
925320134 2:2959637-2959659 CAGTCTTGGCTCTGGTGTATGGG + Intergenic
926447523 2:12962064-12962086 CATTCTGAGGACTGGGGAATAGG - Intergenic
926840389 2:17073317-17073339 CAGTCTTAGAACTGGGTAATGGG + Intergenic
927908189 2:26876926-26876948 CAGTAACAGCACTGGTGAATGGG - Intronic
928167969 2:28984475-28984497 AAGTCTCAGCAAAGGTGTATTGG - Intronic
929762023 2:44814757-44814779 CAGCCTCAGCCCTGGTGTTTGGG - Intergenic
930066601 2:47332521-47332543 CAGTCTCAGCACCTGGCTAGGGG + Intergenic
935092099 2:99905091-99905113 CTGTCTCAGCATTGGGGCAGAGG - Intronic
935191363 2:100781271-100781293 CGTACTCAGCACTGGGTTATAGG + Intergenic
935864768 2:107375230-107375252 CTTTCTGAGGACTGGGGTATGGG + Intergenic
937360090 2:121223662-121223684 CTGTCTCTGCACTGGCGCATTGG - Exonic
943359721 2:186902670-186902692 GAGTCCTAGCACTGAGGTATAGG - Intergenic
946015218 2:216598892-216598914 CTGTCTCAGCCATGGGGGATGGG - Intergenic
947341032 2:229139802-229139824 CAGTCTCAGCACTGGAGGATTGG + Intronic
947836610 2:233180434-233180456 CAGGCTGAGCACAGGGGTACAGG - Intronic
947839985 2:233201612-233201634 CAGTCCCTGCACTTGGGTCTGGG - Intronic
948785496 2:240350263-240350285 CTGGCTCAGCACTGGCTTATGGG + Intergenic
1170180970 20:13529738-13529760 CATTCTGAGGACTGGGGAATAGG + Intronic
1170630216 20:18058672-18058694 CAGTCTCAGAATTTGGGGATCGG - Intronic
1172010403 20:31843013-31843035 CAGTCTCAGAGCTGGGGTGGAGG - Intergenic
1173411537 20:42815279-42815301 CAAACACAGCACTGGGGTAGGGG + Intronic
1174324130 20:49765612-49765634 GCGTCTCAGTTCTGGGGTATTGG + Intergenic
1179117491 21:38507443-38507465 CAGTGTCAGCACTGGGGCTCCGG - Intronic
1181793162 22:25283212-25283234 CAGTCTCTGAAATGGGGCATCGG + Intergenic
1181813805 22:25421487-25421509 CAGTCTCTGAAATGGGGCATCGG + Intergenic
1181831767 22:25565307-25565329 CAGTCTCTGAAATGGGGCATCGG + Intronic
1183186770 22:36296112-36296134 CAGACACAGCACTGTGGTAGGGG + Intronic
1184361207 22:44019900-44019922 CAGTCACAGTACTGGGGATTAGG - Intronic
1185318498 22:50189557-50189579 CAGTGCCAGCACTGGGGATTTGG + Intronic
950224208 3:11220466-11220488 CAGGCTCTGCACTGGGTTGTAGG - Intronic
953118531 3:40016322-40016344 CACTCACAGAACTGGGGGATAGG - Intronic
953920429 3:46947764-46947786 CAGGCACAGCACTGTGGTAGAGG + Intronic
954035125 3:47847227-47847249 CAGTCACAGCCCCGGGGTAAGGG - Intronic
954166586 3:48764072-48764094 TAGTCTCAGTACTGGGTTCTAGG + Intronic
954361971 3:50126834-50126856 GAGTCTCAGGGCTGGGGTAGGGG + Intergenic
954700542 3:52448591-52448613 CAGGTTCAGCCGTGGGGTATTGG - Intergenic
956601656 3:71029075-71029097 CAGTCTGTGAACTGGGGTTTGGG + Intronic
956973997 3:74559146-74559168 CAGTGTCAGAACTGGGGTTTAGG - Intergenic
960817925 3:121692433-121692455 CATTCTGAGAACTGTGGTATAGG + Exonic
962180129 3:133197928-133197950 CAGTGTCAGCTATGGGGTAGTGG - Intronic
962436346 3:135370668-135370690 CAGTCTCTGCCCAGGGCTATTGG + Intergenic
965132129 3:164714582-164714604 CATTCTTAGTACTGGGGTTTAGG + Intergenic
966223010 3:177569210-177569232 GAGTCTGAGCACTGGGGGAAAGG - Intergenic
968881907 4:3305274-3305296 CAGTCCCTCCACTGGGGTGTAGG - Intronic
968900406 4:3428883-3428905 CAGTCTCAAAACTGGGGTTTCGG - Intronic
974187007 4:58458639-58458661 CAGTCTCACCACTTGGTAATAGG - Intergenic
977637392 4:99315168-99315190 TAGTCTCAGCACTGAGGCTTTGG + Intronic
979377368 4:119962899-119962921 CAGTCTCATCACTGAGGGATGGG + Intergenic
979494473 4:121368880-121368902 TATTCTCAGCAGTGGTGTATGGG - Intronic
981782419 4:148443860-148443882 AAGTCTCAGCCCTGGGTTAGGGG - Intronic
983401800 4:167275570-167275592 TAGTTGCAGCACTGTGGTATGGG - Intergenic
989216337 5:38908094-38908116 CAGTGGCAGCACAGGGGTAGGGG - Intronic
990545931 5:56821500-56821522 CAGGGTCAGTACTGGGGTGTAGG + Intronic
990627419 5:57630283-57630305 CATTATCAGCATTGGGGTTTTGG + Intergenic
991929466 5:71738207-71738229 CAGCCTGAGCAGTGGGGTTTGGG - Intergenic
992065580 5:73104708-73104730 CAGTCTTCAAACTGGGGTATGGG - Intergenic
993606364 5:89995046-89995068 CAGTGCCAGCAGTGGCGTATGGG - Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
995528598 5:113071108-113071130 CAGCCTCAGCGCTGTGGCATTGG + Exonic
997255921 5:132427888-132427910 CACTCTCAGCATAGGGATATGGG + Intronic
997392787 5:133530813-133530835 AGGTCTCTGCACTGGGGTGTGGG - Intronic
998151534 5:139760165-139760187 CAGGCCCAGGACTGGGGTAGGGG - Intergenic
998253364 5:140567264-140567286 CAGTGCCAGCAATGGGGCATGGG - Exonic
999473406 5:151876189-151876211 TAGTTTCAGCAACGGGGTATAGG - Intronic
1001200014 5:169707567-169707589 CATGCTGTGCACTGGGGTATAGG - Intronic
1001218838 5:169881784-169881806 CAGAATCAGCACTGCCGTATAGG - Intronic
1002018610 5:176347053-176347075 TATTCTCAGCACGGGTGTATGGG - Exonic
1002279161 5:178120732-178120754 GTGCCTCAGCACTGGGGTACAGG + Intronic
1002298703 5:178245825-178245847 CAGTCCCAGCCCTGGGGAAAGGG + Intronic
1002347041 5:178555335-178555357 AAGTCTCAGAATTGGGGCATGGG - Intronic
1004838402 6:19554924-19554946 CACTCTCAGCCTTGGCGTATGGG - Intergenic
1006908414 6:37548285-37548307 CAGACTCAGCTGTGGGGTAGGGG - Intergenic
1007199060 6:40089840-40089862 CAGTCTGAGCTATGGCGTATAGG + Intergenic
1011195967 6:84779636-84779658 CAGGCTCAGCAATGGGAAATTGG - Intergenic
1014728237 6:124999163-124999185 CAGTCTCAGAACTGGACTAGGGG - Intronic
1018179091 6:161205013-161205035 CAGCCTCACCACTGGGGACTGGG + Intronic
1018750114 6:166797053-166797075 CAGTCACAGCACTGGCTTGTCGG + Intronic
1019729772 7:2623488-2623510 CAGTCTCAGCTCTGGAGGCTCGG - Intergenic
1019931313 7:4225172-4225194 CAGTCTCACAACTGGGACATGGG - Intronic
1020191820 7:6005934-6005956 GAGTCTAAGCACTGCGGTAAAGG - Exonic
1020940199 7:14523964-14523986 CAGTATTAGCACTGGTCTATAGG - Intronic
1022883765 7:34620626-34620648 CAGTCCCAGCTCAGGGGTATTGG - Intergenic
1024987312 7:55206486-55206508 CATTCTCAGCTGTGGGCTATTGG - Exonic
1027155649 7:75765679-75765701 CAATCTCAGCACTTTGGTTTGGG + Intergenic
1032015942 7:128380511-128380533 CAATGTCAGCACTGGGGGCTTGG + Intergenic
1032871885 7:135994613-135994635 CAGTGTCAGCACTGAGTTCTAGG + Intergenic
1034825135 7:154255452-154255474 CACTCCCAGCACTGGGGGAAAGG + Intronic
1035692164 8:1567362-1567384 CAGCCTCAGTCCTGGGGTTTTGG + Intronic
1037403297 8:18515432-18515454 CAGCCACAGCTCTGGGGTCTGGG + Intergenic
1038394449 8:27236742-27236764 CGCTCCCAGCACTGGGGTTTGGG - Exonic
1044158520 8:88881967-88881989 CAGTCACAGCAATGGTTTATTGG + Intergenic
1044732149 8:95237895-95237917 CAGTCTCGGGACTGGGGGCTGGG - Intergenic
1044831674 8:96255981-96256003 CAGACTAAAAACTGGGGTATTGG + Intronic
1044859613 8:96509840-96509862 CAGTCTAAGCAGTGTGGAATTGG + Intronic
1047985050 8:130224099-130224121 CAGGCTCAGCACTGGGAACTGGG - Intronic
1049849496 8:144823226-144823248 CAGCCACAGGACTGGGGTTTTGG - Intergenic
1050607872 9:7319924-7319946 GAGTCTCAGCATAGGGGAATAGG + Intergenic
1056803456 9:89710282-89710304 CAGTAACAGCACTGGGTTCTAGG + Intergenic
1058560032 9:106218020-106218042 TAGTCTCAGCAATAAGGTATTGG - Intergenic
1058899176 9:109426968-109426990 CTGTCTCAGTACTGGACTATGGG - Exonic
1059982898 9:119792740-119792762 CAGTTACAGCTCTGGGGTACTGG - Intergenic
1060450531 9:123734463-123734485 CAGTGTCTGCAGTGGAGTATAGG + Intronic
1061107239 9:128540640-128540662 TAGTCTCAGGTCTGGGGAATTGG + Intronic
1061890382 9:133616207-133616229 CAGGCTCAGCACTGGGTGCTGGG + Intergenic
1062366203 9:136210351-136210373 CAGTCTCATGACTGGGGTAGTGG + Intronic
1186005204 X:5062524-5062546 CAGTCTATCCACTGGGCTATTGG + Intergenic
1188189253 X:27154183-27154205 CAGTTTCAGCACTGGTTTTTAGG - Intergenic
1192496272 X:71618278-71618300 CAGAAACAGCACTGGGGAATTGG - Intronic
1194898851 X:99481537-99481559 TATTCACAGGACTGGGGTATGGG - Intergenic
1198514314 X:137389377-137389399 CAGTCTCAGCAAGGGTGCATAGG + Intergenic
1199813050 X:151370175-151370197 CAGGGTCAGCCCTGGGGTAGGGG - Intergenic
1200625731 Y:5512572-5512594 CAAACTCAGCAGTTGGGTATAGG + Intronic