ID: 1067807700

View in Genome Browser
Species Human (GRCh38)
Location 10:49404577-49404599
Sequence GACCTACTCCCTGTTGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067807700_1067807706 0 Left 1067807700 10:49404577-49404599 CCTCCAGCAACAGGGAGTAGGTC No data
Right 1067807706 10:49404600-49404622 CCCTGGATGCAGCCCTGGAGAGG No data
1067807700_1067807710 17 Left 1067807700 10:49404577-49404599 CCTCCAGCAACAGGGAGTAGGTC No data
Right 1067807710 10:49404617-49404639 GAGAGGACCTCAGCTGTCCAAGG No data
1067807700_1067807703 -5 Left 1067807700 10:49404577-49404599 CCTCCAGCAACAGGGAGTAGGTC No data
Right 1067807703 10:49404595-49404617 AGGTCCCCTGGATGCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067807700 Original CRISPR GACCTACTCCCTGTTGCTGG AGG (reversed) Intergenic
No off target data available for this crispr