ID: 1067807921

View in Genome Browser
Species Human (GRCh38)
Location 10:49405934-49405956
Sequence GGACCTGGGTGGGGACAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067807921_1067807926 -10 Left 1067807921 10:49405934-49405956 CCTGCCTGTCCCCACCCAGGTCC No data
Right 1067807926 10:49405947-49405969 ACCCAGGTCCAGACTCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067807921 Original CRISPR GGACCTGGGTGGGGACAGGC AGG (reversed) Intergenic
No off target data available for this crispr