ID: 1067809156

View in Genome Browser
Species Human (GRCh38)
Location 10:49413577-49413599
Sequence ACCTCTTCTATGTTTAGATA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067809153_1067809156 3 Left 1067809153 10:49413551-49413573 CCAGCCTAATACCATATTTTTAC No data
Right 1067809156 10:49413577-49413599 ACCTCTTCTATGTTTAGATACGG No data
1067809155_1067809156 -8 Left 1067809155 10:49413562-49413584 CCATATTTTTACTGCACCTCTTC No data
Right 1067809156 10:49413577-49413599 ACCTCTTCTATGTTTAGATACGG No data
1067809154_1067809156 -1 Left 1067809154 10:49413555-49413577 CCTAATACCATATTTTTACTGCA No data
Right 1067809156 10:49413577-49413599 ACCTCTTCTATGTTTAGATACGG No data
1067809152_1067809156 4 Left 1067809152 10:49413550-49413572 CCCAGCCTAATACCATATTTTTA No data
Right 1067809156 10:49413577-49413599 ACCTCTTCTATGTTTAGATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067809156 Original CRISPR ACCTCTTCTATGTTTAGATA CGG Intergenic
No off target data available for this crispr