ID: 1067811235

View in Genome Browser
Species Human (GRCh38)
Location 10:49428832-49428854
Sequence CCTCCTGGGCAGAGGGTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067811221_1067811235 25 Left 1067811221 10:49428784-49428806 CCTGCTCTGGAGGGAAAGGTTTG No data
Right 1067811235 10:49428832-49428854 CCTCCTGGGCAGAGGGTAGTAGG No data
1067811228_1067811235 -5 Left 1067811228 10:49428814-49428836 CCTGGGACAGATGAGCCTCCTCC No data
Right 1067811235 10:49428832-49428854 CCTCCTGGGCAGAGGGTAGTAGG No data
1067811227_1067811235 -4 Left 1067811227 10:49428813-49428835 CCCTGGGACAGATGAGCCTCCTC No data
Right 1067811235 10:49428832-49428854 CCTCCTGGGCAGAGGGTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067811235 Original CRISPR CCTCCTGGGCAGAGGGTAGT AGG Intergenic
No off target data available for this crispr