ID: 1067812591

View in Genome Browser
Species Human (GRCh38)
Location 10:49441618-49441640
Sequence GCCGCCGGCGTCTCCGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067812584_1067812591 20 Left 1067812584 10:49441575-49441597 CCATTTTGCATTCTGATTTCTTA No data
Right 1067812591 10:49441618-49441640 GCCGCCGGCGTCTCCGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067812591 Original CRISPR GCCGCCGGCGTCTCCGCAGG TGG Intergenic
No off target data available for this crispr