ID: 1067815332

View in Genome Browser
Species Human (GRCh38)
Location 10:49471239-49471261
Sequence TTTCCAAGGCTGAAAGTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 262}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067815332_1067815337 21 Left 1067815332 10:49471239-49471261 CCCCAAACTTTCAGCCTTGGAAA 0: 1
1: 0
2: 2
3: 25
4: 262
Right 1067815337 10:49471283-49471305 AATACATCAGTTAATCTCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 186
1067815332_1067815335 -10 Left 1067815332 10:49471239-49471261 CCCCAAACTTTCAGCCTTGGAAA 0: 1
1: 0
2: 2
3: 25
4: 262
Right 1067815335 10:49471252-49471274 GCCTTGGAAAATTACAATTCAGG 0: 1
1: 0
2: 0
3: 12
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067815332 Original CRISPR TTTCCAAGGCTGAAAGTTTG GGG (reversed) Intronic
900818341 1:4867573-4867595 TTTCGAAGGCATAAAGTGTGTGG + Intergenic
903613811 1:24637409-24637431 TTTCTGAGGCTCAGAGTTTGAGG + Intronic
904018175 1:27440618-27440640 TTACCTAGGCTGAAATTTAGTGG + Intronic
905439359 1:37984497-37984519 TTTCCAAGCCAGTAAATTTGAGG + Intronic
905913285 1:41668475-41668497 ATTGCAAGGCTGAAGGATTGGGG - Intronic
906095874 1:43223540-43223562 TTTCCAGGGCTAAATGTTTTGGG - Intronic
906825107 1:48971106-48971128 TGTCCAAGGCTGGGGGTTTGGGG - Intronic
907605579 1:55814098-55814120 TTACCAAGGCTGCCAGTATGCGG + Intergenic
907908571 1:58807446-58807468 CTTCCAAGGCCTAAAGGTTGAGG + Intergenic
908380674 1:63594080-63594102 CTTCCAAGGCTGCAAGGTTAGGG - Intronic
908850015 1:68366396-68366418 GGTCCAAGGATGAAAGCTTGAGG - Intergenic
909206003 1:72758747-72758769 TTTCCAACACATAAAGTTTGGGG + Intergenic
909929535 1:81479796-81479818 TTTCTAAAGCTTAAATTTTGTGG + Intronic
910015915 1:82523064-82523086 TTTCTAAGCCTGAAGGATTGAGG + Intergenic
910297410 1:85663868-85663890 TTTACAAGCCAGAGAGTTTGGGG - Intronic
910719629 1:90271877-90271899 TTTCCATGACTGAAAGGTGGAGG + Intergenic
912562428 1:110560447-110560469 TTGCCAACTTTGAAAGTTTGTGG + Intergenic
915167626 1:153957471-153957493 TTTCCAAGGCTGGAGGTCAGAGG - Intronic
916755772 1:167768916-167768938 TTTGCAAAGCTGAGAGTTTATGG + Intronic
916964140 1:169917903-169917925 AGTCCAAGGCTGGAAGTCTGAGG - Intergenic
920966634 1:210706538-210706560 TTTCCAGCCCTGACAGTTTGTGG - Intronic
921672004 1:217935669-217935691 TTTGGAAGGCTAGAAGTTTGAGG - Intergenic
922564357 1:226591838-226591860 TTTCCTAGGCTGAAAGAGTGAGG + Intronic
924687464 1:246309501-246309523 TTTACCAGGTAGAAAGTTTGAGG + Intronic
1062863728 10:831533-831555 TTTCCCAGGCTGAAGATGTGGGG - Intronic
1064339738 10:14475206-14475228 TTCCCGAGGCTGGAAGTCTGAGG - Intergenic
1065399973 10:25288030-25288052 TTTCCATTACTGAAAGTTAGGGG + Intronic
1067520512 10:46998469-46998491 TTTCCAAGGGTTAGAGATTGGGG + Intronic
1067815332 10:49471239-49471261 TTTCCAAGGCTGAAAGTTTGGGG - Intronic
1069168684 10:65197221-65197243 TTTTGAAGGCTGAAAGTCTGGGG - Intergenic
1069354707 10:67571413-67571435 TTTCCAAGGATCACAGTTTGAGG - Intronic
1069766883 10:70868703-70868725 TTTCCAAAAGTGAGAGTTTGAGG + Intronic
1070974725 10:80597288-80597310 TTTTCCAGGCTGAGATTTTGAGG - Intronic
1071300209 10:84250752-84250774 TTTCTAAAGCTGAAAGTCTGAGG + Intronic
1071587351 10:86837104-86837126 TTTCCTTGGCTAAAAGTTTTAGG - Intronic
1071888038 10:89972007-89972029 TTTCAAAGGCAGAAGGATTGTGG + Intergenic
1072065450 10:91865608-91865630 TTTCCAAATCTCAAAGTTAGTGG + Intergenic
1072551336 10:96479833-96479855 TTGCAAAGGCAGAAAGTATGGGG - Intronic
1073539301 10:104305477-104305499 TTTCCAAGGGTTAAAATGTGAGG + Intergenic
1077797209 11:5505282-5505304 CTTCCAAGGATGGAAATTTGGGG + Intronic
1081790176 11:45776942-45776964 TTTCCAGGTCTGAAAGGTAGAGG - Intergenic
1083947826 11:65934954-65934976 TATCCAAGGCTGAGAGTGTAAGG - Intergenic
1085871700 11:80357894-80357916 TTTACAAGGATGAAATTTTCTGG + Intergenic
1087862798 11:103183274-103183296 TTTCCAATGCAGATACTTTGAGG + Intronic
1089226340 11:116925583-116925605 TTTCCAAGTCATTAAGTTTGTGG + Intronic
1089371585 11:117963686-117963708 TTTCCAATACTGGAAATTTGTGG - Intergenic
1089827733 11:121293620-121293642 TTTCCAAACTGGAAAGTTTGTGG + Intronic
1090263431 11:125339109-125339131 TTTCCAAGGCTGGAGGTTGAAGG + Intronic
1091569258 12:1670299-1670321 TTTCTCAGGCTGAGAATTTGAGG + Intergenic
1093173893 12:15889316-15889338 AATCAAAGGCTGATAGTTTGGGG + Intronic
1094017193 12:25877937-25877959 TTTTCAGAGTTGAAAGTTTGGGG + Intergenic
1095929790 12:47613896-47613918 TTTCCAAGACATAAATTTTGGGG + Intergenic
1097269866 12:57767313-57767335 TTTCCTAGGATGAGACTTTGAGG - Intronic
1098771786 12:74561801-74561823 TTTCCAAAGCACAAACTTTGAGG - Intergenic
1099028196 12:77492032-77492054 TTTCCAAGGCAGCAAGAATGAGG - Intergenic
1099592391 12:84611304-84611326 TTTCAAACATTGAAAGTTTGTGG + Intergenic
1099969044 12:89481615-89481637 TTTCCAATGCAGAATTTTTGGGG - Intronic
1101126129 12:101635167-101635189 TTACCAAGGCTGAAAAATGGAGG + Intronic
1103119977 12:118372426-118372448 GGTCCAAGACTGAAAGTCTGAGG - Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1107031250 13:35856013-35856035 TTTCCAGGGTTGTAAGTTTTTGG - Intronic
1107083648 13:36402561-36402583 TGTCCAATGCTGAAAGTCAGGGG + Intergenic
1109487694 13:63049855-63049877 TATTTAAGGCTGAAAATTTGAGG - Intergenic
1109606188 13:64700582-64700604 TTTTAAATTCTGAAAGTTTGGGG + Intergenic
1109892407 13:68632247-68632269 TTTCCAACACTTGAAGTTTGGGG + Intergenic
1110264619 13:73523196-73523218 TTGCCAAGGCCCGAAGTTTGTGG + Intergenic
1110573798 13:77033977-77033999 CTTCCAAGGATGAAAGAATGTGG + Intergenic
1110927217 13:81168665-81168687 TTTCTATGTCTGAAAATTTGTGG + Intergenic
1111191293 13:84810510-84810532 TTTCAAAGCCAGAAAATTTGGGG - Intergenic
1111726078 13:92010815-92010837 TTCCGAAAGCTGAAAGTTTAAGG - Intronic
1114435286 14:22701472-22701494 TATCCAAAGCTCAGAGTTTGTGG + Intergenic
1114697457 14:24640218-24640240 TTTCTAAGCCTGAAAGATTGAGG + Intergenic
1114723123 14:24904510-24904532 CTTCAAAGGCTGAATTTTTGGGG - Intronic
1114838698 14:26235625-26235647 TTTCCGATGATGTAAGTTTGGGG + Intergenic
1115061318 14:29194055-29194077 TTTGCATGGCGGAAAGTTGGAGG - Intergenic
1115661403 14:35498281-35498303 TTTCCAATGCTGAAAGTTGGGGG - Intergenic
1116521578 14:45854455-45854477 TTTACATCGCTGAAAGTTTCTGG - Intergenic
1116803129 14:49464269-49464291 TTTCCTGAGCTGAAGGTTTGTGG + Intergenic
1117057035 14:51922870-51922892 TTTCCAAGGCTGCAGGGTGGGGG + Intronic
1119539089 14:75427486-75427508 TGTCCAAGGATGAAACTGTGCGG + Intergenic
1120841327 14:89087732-89087754 TTTCCAACACAGAAACTTTGAGG - Intergenic
1121373393 14:93381905-93381927 TTCCTAAGACTGAAAGCTTGAGG - Intronic
1122211483 14:100176888-100176910 TTTCCAAGGCTGAGGGGTGGTGG - Intergenic
1122370697 14:101227489-101227511 TCTCCAGGGCTGATGGTTTGTGG - Intergenic
1122381903 14:101313782-101313804 TCTCCAGGGCTGATAGTTTGCGG + Intergenic
1122457043 14:101862214-101862236 TTTCCAAAACTGAAAATTTCTGG - Intronic
1123519624 15:21059974-21059996 TTTCCCAGGCTGAAGGTCAGTGG + Intergenic
1124478807 15:30059724-30059746 TTTCCAAGCCTGCCATTTTGGGG + Intergenic
1125926246 15:43565523-43565545 TTCCCAAGAATGAAAGTATGAGG + Intronic
1125939390 15:43665074-43665096 TTCCCAAGAATGAAAGTATGAGG + Intronic
1126301385 15:47200689-47200711 TTACTAAGGCTGACATTTTGAGG + Intronic
1126337351 15:47601305-47601327 TTACCAAAGCTGAAAGGTTAGGG - Intronic
1126876352 15:53045727-53045749 TTTCCCAGGCTGAAGTGTTGTGG + Intergenic
1129079072 15:73023667-73023689 TTTCCAAAGCTGAATCTTTGAGG - Intergenic
1129642570 15:77394870-77394892 TTTCAAAGGATAAATGTTTGAGG + Intronic
1129783704 15:78293132-78293154 TTTCCAAGGCTGTATGTTAGGGG + Intronic
1130057044 15:80535432-80535454 TTTGCCAGTCTGATAGTTTGTGG + Intronic
1131234911 15:90687722-90687744 TTTCAAAGAATGAAATTTTGTGG + Intergenic
1132142433 15:99406824-99406846 TTTCCAGAGCCAAAAGTTTGTGG + Intergenic
1135347321 16:21700249-21700271 TCTTCAAAGCAGAAAGTTTGTGG + Intronic
1137788585 16:51155595-51155617 TTTCCTTGTCTGAAAGTTTGCGG + Intergenic
1137840851 16:51639674-51639696 ATTCCAAGGATGAAAGCTTCAGG + Intergenic
1137939571 16:52670422-52670444 TCTCCAAGACTGAAAGAATGTGG + Intergenic
1138610019 16:58115552-58115574 TTCCCAAGGCTGAGACTTAGAGG + Intronic
1139844774 16:69912540-69912562 TTCCCCAGGCTGAAAATTGGAGG + Intronic
1140053696 16:71506060-71506082 TATACAAGTTTGAAAGTTTGTGG - Intronic
1140288470 16:73627420-73627442 TTTGCAAGCCGGAAAGTTTGAGG + Intergenic
1144084206 17:11793987-11794009 TTTCCAAGGCCGCCATTTTGGGG + Intronic
1146130080 17:30265427-30265449 TTTCCAAGGGTAAAAGGTAGAGG - Intronic
1146234792 17:31148675-31148697 TTTCCCATGCTGAAAGTCTTGGG + Intronic
1149368392 17:55968150-55968172 TTTTCAAAGCTGATAGTTGGTGG - Intergenic
1151998957 17:77632682-77632704 TTCTGAAGGCTGAAAGTTTGAGG - Intergenic
1152219590 17:79055709-79055731 TTTCCAAGGCTGCTTGTGTGTGG + Intergenic
1155238672 18:23845765-23845787 TTCCCAAGGCTGCAAGGTTATGG - Intronic
1155720404 18:29004120-29004142 TTTCTAAAGCTGAGAGTCTGAGG - Intergenic
1155910762 18:31502211-31502233 TTTCCAAGGCTAATATTCTGTGG + Intronic
1156529115 18:37797845-37797867 TTTCCTAGGCTAAAAGTTCTGGG + Intergenic
1157132680 18:45022136-45022158 TTTCCATGGCTGAGTGTTTATGG + Intronic
1157675386 18:49564669-49564691 TTTCCAATTTTGAGAGTTTGTGG - Intronic
1162047477 19:8010183-8010205 TTGCCCAGGCTGAAATGTTGTGG - Intronic
1162783616 19:13020618-13020640 TTCCCAGGGCAGAAAGTTGGAGG - Intronic
925777860 2:7352513-7352535 TTTCCAAAGCTGAAACTTGAAGG - Intergenic
927043445 2:19253408-19253430 TCTCCCAGGCTGAAAGTCTCAGG + Intergenic
928171270 2:29004400-29004422 TTTTCAAGTCCAAAAGTTTGTGG - Intronic
933824566 2:86147059-86147081 TTTCTAAAGCTGACAATTTGTGG - Intronic
933914020 2:86970483-86970505 TTGCCAAGGCTGAGAGGTTTGGG - Intronic
934008973 2:87799415-87799437 TTGCCAAGGCTGAGAGGTTTGGG + Intronic
935128388 2:100243262-100243284 TGTCCAAGGCTGAAGGTGTGAGG - Intergenic
935772562 2:106440106-106440128 TTGCCAAGGCTGAGAGGTTTGGG + Intronic
935907510 2:107855808-107855830 TTGCCAAGGCTGAGAGGTTTGGG - Intronic
935993913 2:108747963-108747985 TTGCCAAGGCTGAGAGGTTTGGG - Intronic
936129301 2:109820950-109820972 TTGCCAAGGCTGAGAGGTTTGGG - Intronic
936215396 2:110550535-110550557 TTGCCAAGGCTGAGAGGTTTGGG + Intronic
936424533 2:112405108-112405130 TTGCCAAGGCTGAGAGGTTTGGG + Intronic
937570363 2:123350704-123350726 TTTCAAATGCTGAATGTTTCTGG - Intergenic
938128799 2:128693478-128693500 TTTCCATGGCTGTAAGTTAGTGG + Intergenic
938963198 2:136361405-136361427 TTTCCAGGGCTGCATTTTTGGGG + Intergenic
939512306 2:143122584-143122606 TTTCAAGGGCTGAAGGTTGGTGG - Intronic
941447037 2:165615134-165615156 TTTCCAATGCTGAAATGTGGTGG + Intronic
941605579 2:167592430-167592452 TTTCTATGGCTGCAGGTTTGTGG + Intergenic
942911335 2:181247636-181247658 TTTCCAAGCCTGAAGATTGGAGG - Intergenic
943237563 2:185341487-185341509 AATCCAAGGCTGAAAGCTTCAGG - Intergenic
946270239 2:218586230-218586252 TTTCAAAGCATGAAATTTTGGGG - Intronic
946525576 2:220515670-220515692 TTTCCAAGGCTCAAACCTTGAGG - Intergenic
947175167 2:227358898-227358920 CTTCCAAGGCAGGGAGTTTGGGG + Intergenic
1170654865 20:18277004-18277026 TTTCCAGGAATGAAAGTATGTGG - Intergenic
1170746232 20:19101272-19101294 TCTCCAAGGCTGAGATTTAGGGG - Intergenic
1174177683 20:48655451-48655473 TTTCCAAGGCAGAAAGTCTCTGG - Intronic
1174706620 20:52662882-52662904 TATCCAGGGCTGAAAGCTGGTGG - Intergenic
1175276241 20:57772788-57772810 TTTCCTTGGCTGGGAGTTTGGGG + Intergenic
1175788720 20:61728176-61728198 TTTCCAAGGCTGTGAGTGAGTGG + Intronic
1177269503 21:18828973-18828995 TTTCAAAAGCTCAATGTTTGAGG - Intergenic
1177383162 21:20371754-20371776 TTTTTAAGATTGAAAGTTTGTGG - Intergenic
1178265491 21:31138893-31138915 TTTCCAAGCCAGAAATTTTCTGG + Intronic
1178410704 21:32361595-32361617 TTTCCAGGGATGACAGTATGGGG - Intronic
1178764298 21:35434726-35434748 CTTCCAGGACTGAAAATTTGTGG - Intronic
1180771569 22:18391037-18391059 TTTGGCAGGCTGAAAGTGTGGGG + Intergenic
1182635883 22:31726634-31726656 GTTCTCAGGCTGAATGTTTGAGG + Intronic
1182893359 22:33837861-33837883 TTTCCCACCCTGAAACTTTGTGG - Intronic
1183023640 22:35047490-35047512 TTTGCCAGGCTGAAAGGTTCGGG + Intergenic
1183313795 22:37126432-37126454 TTTCCAAGGCTCAACGCTTGTGG + Exonic
1185090737 22:48770713-48770735 TTTGCAGGTCTGTAAGTTTGAGG + Intronic
949140529 3:627722-627744 TTTCACAGGCTGATAGTTGGAGG - Intergenic
949387278 3:3517223-3517245 CTTCCAGGGCTGAAATTTTATGG + Intergenic
949587450 3:5455753-5455775 ATTCTATGACTGAAAGTTTGAGG - Intergenic
951542510 3:23795687-23795709 TTTACAAGTGAGAAAGTTTGGGG + Intergenic
951979467 3:28549612-28549634 TTCTGAAGGCTGGAAGTTTGAGG + Intergenic
952117306 3:30198191-30198213 TTGGCAAGGCTGAAAGTCAGAGG + Intergenic
952327876 3:32337206-32337228 TTTCCAACACATAAAGTTTGGGG + Intronic
953590230 3:44244730-44244752 TTTCGTATGCTCAAAGTTTGAGG - Exonic
955749649 3:62174859-62174881 TTTCCTATGCTAAAAGTTTCTGG - Intronic
956122273 3:65978308-65978330 GATCCAAGTCTGGAAGTTTGTGG + Intronic
959542935 3:107560678-107560700 TTTCCTAGGCCAAAAGTTTCTGG + Intronic
960096987 3:113698481-113698503 TTGCCAAGGCTGAAGGTCAGTGG + Intergenic
960627218 3:119692808-119692830 TTTCAAAAGATGAAAATTTGTGG - Intergenic
960887318 3:122409276-122409298 TTCCCAAAGCTGAATGTTTTTGG + Intronic
962029999 3:131589630-131589652 TTTCAAAGACTGTAAGTGTGAGG - Intronic
962730418 3:138278085-138278107 TATCCAAGCCTTAAAGGTTGGGG + Intronic
964476684 3:157104019-157104041 TTTCCACAGATGAGAGTTTGGGG - Intergenic
964781207 3:160340355-160340377 TTTCTAAGGCTCTAAATTTGTGG - Intronic
965358558 3:167709101-167709123 TTTACTATGCTCAAAGTTTGAGG + Intronic
966083087 3:176029691-176029713 TTTTTAAGCCAGAAAGTTTGTGG - Intergenic
966949803 3:184805934-184805956 TTTCTAAGGCTGAAAGAAAGAGG + Intergenic
967038689 3:185669310-185669332 ATTCCAAGAGTGAAAATTTGGGG + Intronic
967143311 3:186582902-186582924 TCTACAAGGCTGAAAACTTGGGG + Intronic
967738130 3:192975477-192975499 TGTCCAACGCTGAAAGTGGGAGG - Intergenic
969685626 4:8672450-8672472 TTTCCAAGGCAGCAGGTCTGGGG - Intergenic
969964777 4:10982995-10983017 GTCCCCAGGCTGAAAGTGTGGGG + Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
972458111 4:39273685-39273707 TTTCCAAGGATGACAGTCTCAGG + Intronic
973258126 4:48134051-48134073 TTTCCAAGGCATAGAGCTTGGGG - Intronic
975134853 4:70864813-70864835 TTCTCAAGACTCAAAGTTTGAGG + Intergenic
976450802 4:85188805-85188827 TATCCAATGCTGAAAGTTGGGGG + Intergenic
977258168 4:94763248-94763270 TTTCCAAAGCTGAGGGTTAGAGG - Intronic
977755343 4:100664153-100664175 TTTCTAAGGATGAAAAATTGGGG + Intronic
978089958 4:104703077-104703099 GTACCATGGCTGAAATTTTGTGG - Intergenic
979289537 4:118964701-118964723 TTTCCAAGGAAGAAAGTTTACGG + Intronic
979397124 4:120202342-120202364 TCTCCCAGGCAGAAAGGTTGGGG - Intergenic
979418192 4:120469685-120469707 TTTCCAAGACATAAAATTTGGGG - Intergenic
980000673 4:127484178-127484200 TATCCAGAGCTGAAGGTTTGAGG - Intergenic
980069057 4:128223349-128223371 TTTCAAAACCTTAAAGTTTGTGG + Intergenic
980262451 4:130468641-130468663 TATCCAAGTCAGAAAGTCTGGGG + Intergenic
980676115 4:136083770-136083792 TCTCCAAAGCTGAAGATTTGTGG + Intergenic
981660341 4:147158688-147158710 TTTCTAAAGCTAATAGTTTGTGG + Intergenic
981798434 4:148627186-148627208 TCTCCATGGCTGAAACTTTAAGG - Intergenic
982507755 4:156241267-156241289 TTTCCGAGCTTGAATGTTTGGGG + Intergenic
982834532 4:160108046-160108068 TTTCCAATGCTGATAGGTTAAGG + Intergenic
983310089 4:166048351-166048373 TTTTCAAGGCTGGAAGTTCAAGG - Intronic
984532969 4:180940175-180940197 TTTCCTAGGCTTCATGTTTGAGG - Intergenic
984609034 4:181817546-181817568 TTTCCAAGGCATAAATTTTGGGG - Intergenic
984800646 4:183713338-183713360 TTTCCTAGACTGAAAGTTTTTGG + Exonic
984870716 4:184322657-184322679 TGTCCATGGCCTAAAGTTTGTGG - Intergenic
985180340 4:187254146-187254168 TTTGCATAGCTGAAGGTTTGGGG - Intergenic
986061142 5:4192215-4192237 TCTCCTTCGCTGAAAGTTTGGGG + Intergenic
987260970 5:16202872-16202894 TTTCCAAGGATGAAATGTTTAGG + Intergenic
987571125 5:19660906-19660928 GTTTCAAGCCTGAAAGTGTGTGG + Intronic
987913088 5:24175441-24175463 TTTCCAAACCTGAAAGCTTGGGG + Intronic
988389278 5:30606593-30606615 ATTTCAAGGGTGAAAGATTGAGG + Intergenic
991148831 5:63341351-63341373 TTTACAAGCCACAAAGTTTGTGG + Intergenic
992225271 5:74614325-74614347 TATCCATGGCTCAAAGTCTGTGG - Intergenic
993104556 5:83585305-83585327 GTTCCAAGGAACAAAGTTTGAGG - Intergenic
993423541 5:87733178-87733200 TTTCCAATTCTGAAAATTAGTGG + Intergenic
995165935 5:109041802-109041824 TTTTCAAAGCTGAGAGTTTCAGG + Intronic
996973499 5:129401844-129401866 TTTCCAAGACTGGAAGATTAGGG - Intergenic
998430816 5:142068415-142068437 TATACAAGTCTGCAAGTTTGTGG - Intergenic
999553976 5:152720935-152720957 TTTCCCATCCTGAAAGTTTTAGG - Intergenic
999919432 5:156303066-156303088 TGTCCAAGGCTGGAGGGTTGGGG - Intronic
1001083695 5:168685288-168685310 TTGCCAAGGTTGAAAGTTGCTGG + Intronic
1005211713 6:23473249-23473271 TCTCCAAATTTGAAAGTTTGGGG - Intergenic
1005706733 6:28462231-28462253 TTTAAAAGGCTGAAAGGTTGTGG + Intergenic
1006707849 6:36037391-36037413 GCTCCAAGGCTGAATGTTGGGGG + Intronic
1007707571 6:43800083-43800105 TTTCCCTGGTTGACAGTTTGAGG + Intergenic
1007829270 6:44625896-44625918 TTTCTAATGAAGAAAGTTTGGGG - Intergenic
1007895500 6:45352232-45352254 TTTCTAAGGCTGAAATTGTCAGG - Intronic
1007901867 6:45420806-45420828 TTTTGAAGGCTCAGAGTTTGAGG + Intronic
1008487265 6:52049947-52049969 TTTCTAAGGCAGTAGGTTTGGGG - Intronic
1008691578 6:53984925-53984947 TTTCCAGGACTGAAAAATTGTGG - Intronic
1010264104 6:73848627-73848649 TGTCTAATGCTGAAAGTTGGGGG + Intergenic
1010697312 6:78992491-78992513 TTTCACAAGCTGCAAGTTTGTGG + Intronic
1011111621 6:83843549-83843571 TTCCCAAGACCAAAAGTTTGAGG + Intergenic
1016193341 6:141298421-141298443 TTTCCAAAGCAGAAAGCATGTGG + Intergenic
1017349975 6:153428395-153428417 TTTCCAAGACTGCAACTTTTGGG - Intergenic
1018120591 6:160631366-160631388 TTTCCAATTCTGACAGTTTCCGG + Intronic
1018126320 6:160685931-160685953 TGTCCAAGGGGGGAAGTTTGAGG + Intergenic
1020561662 7:9735812-9735834 TTTCCTTGTCTGACAGTTTGAGG + Intergenic
1020669857 7:11093364-11093386 TTTTCAAGGCTGTTAGTATGGGG + Intronic
1021637953 7:22709746-22709768 TTTCCAAAGCTGGCACTTTGGGG - Intergenic
1022438480 7:30412600-30412622 TTTCCAAGGCTGAATACCTGTGG - Intergenic
1024723148 7:52161126-52161148 TTTCTAAAGCTGAAAGTATATGG - Intergenic
1026473313 7:70712573-70712595 TTTCCAATTCTGTAGGTTTGGGG - Intronic
1027172522 7:75882843-75882865 ATTCAAAGGCTGAATCTTTGTGG + Intronic
1028452294 7:90999166-90999188 TTTCCAAAACTCGAAGTTTGGGG + Intronic
1032056459 7:128688577-128688599 TTTTCAGGAGTGAAAGTTTGTGG - Intergenic
1033189675 7:139265920-139265942 TTTTCAAGCCAAAAAGTTTGTGG + Intronic
1033525221 7:142206695-142206717 TTTACAAGTTTGAAAGTTTCAGG - Intronic
1035950560 8:4016008-4016030 TGTCCAAGGCTGAAAGACAGTGG - Intronic
1036736777 8:11326017-11326039 TTTTAAAGGATGAAATTTTGTGG + Exonic
1036757409 8:11480509-11480531 TGTTGAAGGCTGAAAGTATGAGG + Intergenic
1036762634 8:11520435-11520457 TTGCCCAGGCTGGAAGTGTGTGG - Intronic
1040916087 8:52567134-52567156 TTTTCAAGCCTGACAGTTTGGGG + Intergenic
1041718044 8:60950064-60950086 TTTCAAAGGCTGAAAACTGGGGG - Intergenic
1042110614 8:65377606-65377628 TGACCATGGCTGATAGTTTGGGG - Intergenic
1044173499 8:89087031-89087053 TTTGAAAGGCTGAAATGTTGAGG - Intergenic
1045207712 8:100059704-100059726 TGTCCAATGCTGAAAGTCAGAGG - Intronic
1047400622 8:124543465-124543487 TTTCACAGATTGAAAGTTTGTGG + Intronic
1049611689 8:143558840-143558862 TGTCCAAGGCTGAGGCTTTGGGG - Intronic
1050102633 9:2134898-2134920 TTTCGGAGGCTGGAAGTCTGAGG - Intronic
1050462770 9:5891281-5891303 TTGCCAAGGCTCTGAGTTTGAGG + Intronic
1052450793 9:28628548-28628570 TTTCCAAGGCTTTTATTTTGGGG + Intronic
1052964265 9:34327627-34327649 TTTGGAAGGCTGAGAGTGTGTGG + Intronic
1053031691 9:34785575-34785597 TTTCCAAGCCACTAAGTTTGTGG + Intergenic
1054927009 9:70599916-70599938 TTTCCTAGACTGAAACTCTGAGG + Intronic
1055503335 9:76923559-76923581 TTTCCAGGGGTTAAGGTTTGGGG - Intergenic
1056781707 9:89555628-89555650 TTTCCAGCCCTGAAAGGTTGTGG - Intergenic
1056941614 9:90961077-90961099 TTTCACAGGCTGAAATTGTGAGG - Intergenic
1059148275 9:111921848-111921870 TTTCCCAGGCTGAAATGTAGTGG + Intronic
1185556487 X:1025394-1025416 TTTGCAAGGGTGAAAGTTGAAGG + Intergenic
1185558608 X:1040932-1040954 TTTCCAAGGTGCAAAGTATGAGG - Intergenic
1185985339 X:4826533-4826555 TTTCCATGGATGAAGGTTGGAGG + Intergenic
1187303867 X:18077493-18077515 GTTCCAAGGCTGAAAGATTTGGG + Intergenic
1188380392 X:29484445-29484467 TTTCCAACACATAAAGTTTGGGG + Intronic
1188672797 X:32900379-32900401 TTTCCCAGGCTGAAGTTTAGTGG + Intronic
1190446396 X:50529404-50529426 TTTCCAAAACTAAAAATTTGGGG + Intergenic
1194590802 X:95797770-95797792 TTCCCAAGACTGAACTTTTGTGG - Intergenic
1195014283 X:100763319-100763341 AGTCCAAGTCTGAAGGTTTGAGG + Intergenic
1195493223 X:105498616-105498638 TTTTGAAGTCAGAAAGTTTGAGG - Intronic
1196077957 X:111598153-111598175 TTTCTAAGCCTGAGAATTTGGGG + Intergenic
1196106943 X:111906542-111906564 TTTCCAAAGCTGGAAGTTGGGGG - Intronic
1198425104 X:136510449-136510471 TTTCTAAGTCTGAAAGTTTGAGG + Intronic
1198785203 X:140280505-140280527 TGTCCAATGCTGAAAGTGAGGGG + Intergenic