ID: 1067818174

View in Genome Browser
Species Human (GRCh38)
Location 10:49499603-49499625
Sequence CTACTGAAACACAAGGAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067818169_1067818174 16 Left 1067818169 10:49499564-49499586 CCCTCTAGCAACTACCTTGCTCT 0: 1
1: 0
2: 1
3: 13
4: 122
Right 1067818174 10:49499603-49499625 CTACTGAAACACAAGGAGCTCGG No data
1067818171_1067818174 2 Left 1067818171 10:49499578-49499600 CCTTGCTCTTACTCTTTATATAA 0: 1
1: 1
2: 2
3: 29
4: 373
Right 1067818174 10:49499603-49499625 CTACTGAAACACAAGGAGCTCGG No data
1067818168_1067818174 17 Left 1067818168 10:49499563-49499585 CCCCTCTAGCAACTACCTTGCTC 0: 1
1: 0
2: 2
3: 9
4: 122
Right 1067818174 10:49499603-49499625 CTACTGAAACACAAGGAGCTCGG No data
1067818167_1067818174 27 Left 1067818167 10:49499553-49499575 CCTGGGCACACCCCTCTAGCAAC 0: 1
1: 0
2: 1
3: 15
4: 125
Right 1067818174 10:49499603-49499625 CTACTGAAACACAAGGAGCTCGG No data
1067818170_1067818174 15 Left 1067818170 10:49499565-49499587 CCTCTAGCAACTACCTTGCTCTT 0: 1
1: 0
2: 1
3: 13
4: 184
Right 1067818174 10:49499603-49499625 CTACTGAAACACAAGGAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067818174 Original CRISPR CTACTGAAACACAAGGAGCT CGG Intronic
No off target data available for this crispr