ID: 1067820921

View in Genome Browser
Species Human (GRCh38)
Location 10:49529452-49529474
Sequence AGCCCACTAGAAGCCCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067820918_1067820921 -10 Left 1067820918 10:49529439-49529461 CCCTTGAAATTCCAGCCCACTAG 0: 1
1: 0
2: 0
3: 15
4: 133
Right 1067820921 10:49529452-49529474 AGCCCACTAGAAGCCCAAGAAGG No data
1067820917_1067820921 21 Left 1067820917 10:49529408-49529430 CCTGAAGTGGTCTCAAGTTTGAT 0: 1
1: 0
2: 1
3: 11
4: 87
Right 1067820921 10:49529452-49529474 AGCCCACTAGAAGCCCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067820921 Original CRISPR AGCCCACTAGAAGCCCAAGA AGG Intronic
No off target data available for this crispr