ID: 1067821496

View in Genome Browser
Species Human (GRCh38)
Location 10:49534968-49534990
Sequence TGACCTCTTGTCCGTGTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067821496_1067821499 11 Left 1067821496 10:49534968-49534990 CCCGGGACACGGACAAGAGGTCA 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1067821499 10:49535002-49535024 AGCGAACTATATATGGTGTCTGG No data
1067821496_1067821500 12 Left 1067821496 10:49534968-49534990 CCCGGGACACGGACAAGAGGTCA 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1067821500 10:49535003-49535025 GCGAACTATATATGGTGTCTGGG No data
1067821496_1067821501 13 Left 1067821496 10:49534968-49534990 CCCGGGACACGGACAAGAGGTCA 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1067821501 10:49535004-49535026 CGAACTATATATGGTGTCTGGGG No data
1067821496_1067821502 30 Left 1067821496 10:49534968-49534990 CCCGGGACACGGACAAGAGGTCA 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1067821502 10:49535021-49535043 CTGGGGCCCAAGAAATATCACGG No data
1067821496_1067821498 4 Left 1067821496 10:49534968-49534990 CCCGGGACACGGACAAGAGGTCA 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1067821498 10:49534995-49535017 AGCATCGAGCGAACTATATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067821496 Original CRISPR TGACCTCTTGTCCGTGTCCC GGG (reversed) Intronic
900974229 1:6007269-6007291 TGGCCACTTGGCCCTGTCCCTGG - Intronic
901236440 1:7669941-7669963 TGGCCTCATGTCCGGGGCCCGGG - Intronic
901772632 1:11538149-11538171 AGAGTTCGTGTCCGTGTCCCGGG + Intergenic
901784790 1:11617382-11617404 AGACCTCCTGCCAGTGTCCCAGG + Intergenic
902884361 1:19393918-19393940 TGTCCTCTTGTGTGTGGCCCTGG - Intronic
904399620 1:30247638-30247660 TGACCTCTTGTCAATGTCGGTGG - Intergenic
906035429 1:42747695-42747717 TGCTCCCTTGTCCTTGTCCCTGG - Intronic
906283118 1:44567365-44567387 CCAACTCTTGTCCCTGTCCCAGG - Intronic
906884614 1:49630912-49630934 TCACCTCTTGTCCCTCTACCAGG - Intronic
908613989 1:65896812-65896834 TGACCTCCTGTCTGGATCCCTGG + Intronic
910607584 1:89103739-89103761 TGATCACTTGTCAGTGTTCCAGG - Intergenic
917132295 1:171755365-171755387 GTACCTCTTGGCCGAGTCCCTGG - Intergenic
1066705781 10:38176003-38176025 TGACCTGTTGTGTGTGCCCCAGG + Intergenic
1066984648 10:42454350-42454372 TGACCTGTTGTGTGTGCCCCAGG - Intergenic
1067821496 10:49534968-49534990 TGACCTCTTGTCCGTGTCCCGGG - Intronic
1070313085 10:75287784-75287806 TGACCTCATATCCATGCCCCTGG + Intergenic
1074123164 10:110508293-110508315 TGACTTGTTCTCCCTGTCCCTGG + Intronic
1075796935 10:125127308-125127330 TGATCTCATGTCTGTGTCACTGG + Intronic
1076054151 10:127357661-127357683 TGACCTCTTGGCCGCTTCTCAGG - Intronic
1077486283 11:2839771-2839793 TCCCCTCTTGTCTGTCTCCCTGG - Intronic
1077776663 11:5279675-5279697 TGACCTCTTGTCAGTCTACTCGG - Intronic
1079136448 11:17778429-17778451 TCCCCTCTGGTCAGTGTCCCCGG - Intronic
1081816736 11:45948882-45948904 TCACCTCTCTTCCGGGTCCCAGG + Exonic
1083282035 11:61632881-61632903 TGAACTCTTGTCGGTCTGCCGGG + Intergenic
1086064447 11:82731869-82731891 TGACCTCCTGTGCTTGTCCTTGG - Exonic
1089379395 11:118016580-118016602 TGGCCTCTTGGCAGTATCCCTGG - Intergenic
1091818707 12:3458474-3458496 TGACCTGTGGTGCGTGGCCCTGG - Intronic
1096355184 12:50935320-50935342 TGACCTCTGCTCCGTTTCTCTGG - Intergenic
1102523938 12:113497553-113497575 TGACCTCCAGTCCCTGCCCCTGG - Intergenic
1103652939 12:122447234-122447256 TTTCCTCTTTTCCCTGTCCCTGG - Intergenic
1103727281 12:123004419-123004441 TGAGCTCTCATCCGAGTCCCTGG + Exonic
1108132870 13:47322323-47322345 TGACATCTTGTCTGTCTCCCTGG + Intergenic
1112898654 13:104333330-104333352 TGACCTCATTTCCGTCTCCATGG - Intergenic
1119872893 14:78032149-78032171 TGACCTCTTGCCTGTGTAACTGG - Intergenic
1121281983 14:92705582-92705604 TTCCCTGTTGTCCCTGTCCCTGG - Intronic
1121686358 14:95838287-95838309 TCACCTCATGTCCATGTCCATGG + Intergenic
1122627587 14:103092123-103092145 TGCCCTCTGGTGGGTGTCCCTGG + Intergenic
1123030588 14:105449436-105449458 CGTCCTCCTGTCTGTGTCCCTGG + Intronic
1125343673 15:38698176-38698198 TGAGCTCTTGTTGGTGGCCCTGG - Exonic
1128354515 15:66915462-66915484 TCATCTCTTCTCCTTGTCCCTGG - Intergenic
1129767646 15:78180579-78180601 TGAGCTCCTGTGCGTTTCCCAGG - Intronic
1132327471 15:100983715-100983737 TGAGCTCTTAACCGTGTCTCAGG + Intronic
1132809148 16:1789428-1789450 TGACTTCTGGTCTCTGTCCCGGG - Intronic
1133244827 16:4441306-4441328 TGAACTCTTGTCTGTATTCCTGG + Intronic
1134183093 16:12063224-12063246 GGACATCTTGTCCATGGCCCAGG + Intronic
1135853413 16:25984934-25984956 TAACCTCTTGGCCTGGTCCCTGG + Intronic
1136231294 16:28887136-28887158 TGACATCATGTCCTTCTCCCAGG - Intronic
1136545087 16:30950010-30950032 TGATCTCTTGTCAGTTTTCCTGG - Intronic
1136912974 16:34159488-34159510 TGGCCGGTTGTCCCTGTCCCCGG + Intergenic
1140958806 16:79892872-79892894 TCACCTATTGTCCGTGTCACAGG + Intergenic
1141029869 16:80578287-80578309 TGACCTCCCATCTGTGTCCCTGG - Intergenic
1141079983 16:81041889-81041911 TCACCTCTTGTCCCAGTCACTGG - Intronic
1141944820 16:87302739-87302761 TGTCCCCATGTCCGTGTCCCTGG - Intronic
1143822609 17:9576889-9576911 GGTCCTCCTGTGCGTGTCCCTGG - Intronic
1145025070 17:19461975-19461997 AGACCTCATGCCAGTGTCCCTGG + Intergenic
1147390395 17:40105890-40105912 GCACCCCTTGTCCCTGTCCCAGG + Intergenic
1152124679 17:78439146-78439168 CCACCTCTTGTCCCTGCCCCAGG + Exonic
1152703767 17:81832759-81832781 TGCCCTCTTTCCCGTCTCCCCGG - Intronic
1152943520 17:83185541-83185563 TGGCCTCTCCTCGGTGTCCCTGG + Intergenic
1153937259 18:9939628-9939650 TAACCTTTTTTCCCTGTCCCTGG + Intronic
1156345051 18:36249474-36249496 TGTCCTCTTGACACTGTCCCAGG - Intronic
1161291567 19:3496517-3496539 TGAGCACCTGTCTGTGTCCCGGG - Intronic
1162700899 19:12513868-12513890 TGACCTGTTGACCGTTGCCCAGG + Intronic
1164627858 19:29741301-29741323 TGTGCTCTTGTCTGTTTCCCAGG + Intergenic
1166765784 19:45251572-45251594 AGACATCTTCTCCGGGTCCCGGG - Exonic
1168239787 19:55083349-55083371 TGAGCTCTTGGCCCTGTCCCTGG + Intronic
925183596 2:1832327-1832349 TGACCTCTATCCCCTGTCCCTGG - Intronic
927522330 2:23706735-23706757 TGGCCTCTTGTTGGTGTCGCTGG - Exonic
929089819 2:38203890-38203912 TGATCTCTTTTCAGAGTCCCAGG - Intergenic
929881154 2:45838314-45838336 TGACCTCTCCTCTGTGCCCCAGG + Intronic
934780982 2:96969566-96969588 TGACTGCTTGTCGGTGTGCCTGG - Intronic
938537234 2:132256755-132256777 TGGCCCGTTGTCCGTGTCCCCGG - Intronic
947626509 2:231622554-231622576 TGACCTCTTGGCCAGGTACCTGG + Intergenic
1169208820 20:3754524-3754546 TGACCAATTGCCCCTGTCCCCGG - Intronic
1169547674 20:6667279-6667301 TCACCTCTTGTCCTTGTTCAGGG - Intergenic
1171364358 20:24613620-24613642 TGCCCTCCTGACCGTGTGCCAGG + Intronic
1171866136 20:30488534-30488556 TGGCCCGTTGTCTGTGTCCCCGG - Intergenic
1173203189 20:40969129-40969151 TGACCTCTGGTCTTTGTTCCTGG - Intergenic
1174192661 20:48751250-48751272 TGACTTCCTGTCAGTATCCCAGG - Intronic
1175404482 20:58717483-58717505 TCATCTCTTGTCCCTGTCTCTGG - Intronic
1176249350 20:64112880-64112902 TGGCCTCAGGGCCGTGTCCCTGG + Intergenic
1176260598 20:64177623-64177645 TGCCCTCTTGTCCCCGCCCCCGG - Intronic
1176424530 21:6539991-6540013 TGACCCCCTCTCTGTGTCCCAGG + Intergenic
1177140404 21:17352409-17352431 TGACCTCTTCCCAGTGTCTCTGG - Intergenic
1179700023 21:43148306-43148328 TGACCCCCTCTCTGTGTCCCAGG + Intergenic
1180312851 22:11253408-11253430 TGGCCCATTGTCCATGTCCCCGG - Intergenic
1180342396 22:11628964-11628986 TGGCCCGTTGTCCGTGTCCCTGG + Intergenic
1182172760 22:28249603-28249625 TGACCTTTTGCCCTTGTCCTTGG - Intronic
1182727528 22:32459971-32459993 TGACCTCTTTTCCTTCACCCAGG - Intronic
1184441589 22:44519963-44519985 TGACATTTTGTCTGTGACCCTGG - Intergenic
1184699286 22:46159339-46159361 TGACCTGTTGACAGTGTCCTTGG + Intronic
1184839324 22:47043340-47043362 TGACCTCGTGCCCGTCGCCCCGG - Intronic
957872453 3:86107179-86107201 TGACCTCTTGCCTGTGTAACTGG + Intergenic
961773665 3:129268568-129268590 TGACCTCAAGTCTGTGCCCCTGG + Exonic
970197797 4:13570054-13570076 TGGCCTCTTGTTCGGGCCCCAGG + Exonic
970710631 4:18858384-18858406 TGAACTCTTAGCTGTGTCCCAGG - Intergenic
974818428 4:67035657-67035679 TGACCAGTTGTCCCTCTCCCAGG + Intergenic
985089728 4:186350674-186350696 TGACCTCCTCTCAGTGTCCAGGG + Intergenic
985384306 4:189429306-189429328 TGTCCGCTTGGCCGAGTCCCTGG - Intergenic
985392513 4:189504940-189504962 TGGCCCCATGTCCTTGTCCCTGG - Intergenic
985652874 5:1115178-1115200 TGGCCTCTTGGCCGTGTGCAGGG + Intergenic
986830046 5:11566785-11566807 TCACCTCTTGTCAGTCTCACAGG + Intronic
986910277 5:12547486-12547508 TGACCTCCTGTCTTTTTCCCTGG - Intergenic
988638513 5:33015148-33015170 TGACCTCTTCTCCCTGCTCCTGG + Intergenic
989351045 5:40487054-40487076 TGACCACTTCTCCATTTCCCTGG - Intergenic
996031606 5:118711712-118711734 TGACCTCTTGTTATTGTCCAAGG - Intergenic
997516887 5:134496244-134496266 GGACCTCATGTCAGTCTCCCTGG - Intergenic
1002426049 5:179176577-179176599 TGTCCTCCTGTCTGTATCCCTGG + Intronic
1002472776 5:179447076-179447098 TGTTCTGTTGTCTGTGTCCCTGG - Intergenic
1002481446 5:179503586-179503608 TGTTCTGTTGTCTGTGTCCCTGG + Intergenic
1003794210 6:9581713-9581735 TGATCTCCTGTCCTTCTCCCAGG - Intergenic
1006273657 6:32983683-32983705 TCACCTCTGGTCCTTGTCCTGGG - Intergenic
1007428879 6:41764803-41764825 TGACCTCGGCTCCGTCTCCCAGG - Intergenic
1009863424 6:69365426-69365448 TGACCTCTTCTGCGAATCCCTGG + Intronic
1013267974 6:108518906-108518928 TAACCTCTTTACAGTGTCCCTGG + Intronic
1022977308 7:35570594-35570616 TGACCTCTAGCACCTGTCCCGGG - Intergenic
1023125226 7:36948591-36948613 TGACCTCTTGACTGTGTGCCAGG + Intronic
1026232385 7:68496564-68496586 TGTACTCTTGTCCTTGGCCCTGG + Intergenic
1026560426 7:71444073-71444095 TGCCCTCTGGGCAGTGTCCCTGG + Intronic
1035137138 7:156714879-156714901 TGTCCTCTTCTCCGTTTCCTTGG - Intronic
1038230026 8:25691122-25691144 TTACCCCTTTTCTGTGTCCCAGG - Intergenic
1039878826 8:41610600-41610622 TGAACTCTGGTCCAGGTCCCAGG + Intronic
1049208855 8:141376168-141376190 TGACCTCTGCGCCTTGTCCCGGG + Intergenic
1049553353 8:143270724-143270746 TGACCTCCTGGCCTTGTCTCTGG - Intronic
1050477196 9:6052458-6052480 TGACATTTTGTCTGTGTCTCTGG + Intergenic
1052242800 9:26294679-26294701 TGACCTGTTGTCTGTGTGCTAGG - Intergenic
1054784949 9:69201459-69201481 AGACCTCATCTCGGTGTCCCTGG + Intronic
1061478433 9:130884467-130884489 TGACCTCCACTCCGTGTCCTTGG - Exonic
1062374927 9:136257772-136257794 TGCCCTCTTGTCCGTGGCTCCGG + Intergenic
1062516928 9:136941512-136941534 GGGCCTCTTGCCAGTGTCCCAGG - Intronic
1203361339 Un_KI270442v1:220887-220909 TGGCCCGTTGTCCGTGTCCCTGG - Intergenic
1186797377 X:13059887-13059909 TGACCTCTTGACCCTTTCCTTGG - Intergenic
1193359284 X:80561538-80561560 TGACCCCCTGTCCCTTTCCCAGG + Intergenic
1195038264 X:100990060-100990082 TAACATCTTATCTGTGTCCCAGG - Intronic
1196970671 X:121104947-121104969 AGACTTCTTTTCCCTGTCCCTGG - Intergenic
1201077108 Y:10196673-10196695 TGGCCCTTTGTTCGTGTCCCCGG + Intergenic