ID: 1067821497

View in Genome Browser
Species Human (GRCh38)
Location 10:49534969-49534991
Sequence GTGACCTCTTGTCCGTGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067821497_1067821502 29 Left 1067821497 10:49534969-49534991 CCGGGACACGGACAAGAGGTCAC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1067821502 10:49535021-49535043 CTGGGGCCCAAGAAATATCACGG No data
1067821497_1067821500 11 Left 1067821497 10:49534969-49534991 CCGGGACACGGACAAGAGGTCAC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1067821500 10:49535003-49535025 GCGAACTATATATGGTGTCTGGG No data
1067821497_1067821501 12 Left 1067821497 10:49534969-49534991 CCGGGACACGGACAAGAGGTCAC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1067821501 10:49535004-49535026 CGAACTATATATGGTGTCTGGGG No data
1067821497_1067821498 3 Left 1067821497 10:49534969-49534991 CCGGGACACGGACAAGAGGTCAC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1067821498 10:49534995-49535017 AGCATCGAGCGAACTATATATGG No data
1067821497_1067821499 10 Left 1067821497 10:49534969-49534991 CCGGGACACGGACAAGAGGTCAC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1067821499 10:49535002-49535024 AGCGAACTATATATGGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067821497 Original CRISPR GTGACCTCTTGTCCGTGTCC CGG (reversed) Intronic
901236441 1:7669942-7669964 GTGGCCTCATGTCCGGGGCCCGG - Intronic
904397568 1:30232434-30232456 GGGACTTCTTGTCCGGGTTCTGG - Intergenic
905477848 1:38241559-38241581 ATGGCCTCTTGTCCATGTCCTGG + Intergenic
911082888 1:93950719-93950741 GTGGCATTTTGTCCCTGTCCTGG - Intergenic
912583456 1:110739957-110739979 GTGACTTCTTGTTCTTTTCCAGG + Intergenic
919917066 1:202145121-202145143 GAGATCTCATCTCCGTGTCCTGG - Intergenic
1063353066 10:5374044-5374066 GGGGACTCTTGGCCGTGTCCTGG - Exonic
1067048431 10:42998918-42998940 GGGACCTGTTGTCCATGGCCAGG - Intergenic
1067821497 10:49534969-49534991 GTGACCTCTTGTCCGTGTCCCGG - Intronic
1069068722 10:63973331-63973353 GTGTCCTCTGGTCCTTTTCCCGG - Intergenic
1069083819 10:64116466-64116488 GTGACATCTGGTGCCTGTCCTGG - Intergenic
1071957951 10:90779557-90779579 GTCACCTCTTCTCTGAGTCCAGG + Intronic
1077413235 11:2413153-2413175 GCGGGCTCTTCTCCGTGTCCAGG + Exonic
1077846163 11:6027126-6027148 GTGCCAACTTGTCTGTGTCCAGG - Exonic
1082937690 11:58671482-58671504 CTGACCTCTTGTCCCTGTCATGG - Intronic
1083012565 11:59417354-59417376 GTGAACTCTTATCCCTGGCCAGG + Intergenic
1084085711 11:66854173-66854195 GTGACCTCTTCTCCATCTCCAGG + Intronic
1084385294 11:68839812-68839834 GTGACCACTGGTCCGGGGCCGGG + Intronic
1084484557 11:69440162-69440184 GTGACCTCATGTTCCTCTCCTGG + Intergenic
1091754229 12:3041209-3041231 GTGTCCTCTTGGCTGTGGCCAGG + Intergenic
1092099246 12:5869641-5869663 GTGATCTCTGGTTTGTGTCCTGG - Intronic
1095233991 12:39775636-39775658 GTGACATCTTGTTTGTTTCCAGG - Intronic
1098489764 12:71061688-71061710 GTGACCTGTTCTCCCTGTACAGG - Intronic
1102224183 12:111216376-111216398 GAGACCTCTGGTCCATGTTCAGG - Intronic
1125524616 15:40367253-40367275 GTGCCCTCTTGTCTGGGACCTGG + Exonic
1127839904 15:62822127-62822149 CTGAGCTCTTGTCTGAGTCCTGG + Intronic
1136343775 16:29662750-29662772 GTGAGCTCTTGACTCTGTCCGGG - Intergenic
1138277809 16:55749002-55749024 CTGACCTCCTGTCTGTTTCCAGG + Intergenic
1138283778 16:55792745-55792767 CTGACCTCCTGTCCGTTCCCAGG + Intergenic
1138285224 16:55804242-55804264 CTGACCTCCTGTCCGTTCCCAGG - Intronic
1142964485 17:3572213-3572235 GGAAGCTCTTCTCCGTGTCCAGG + Exonic
1143598308 17:7928843-7928865 GTGTCCTTGGGTCCGTGTCCTGG - Intronic
1148748033 17:49929282-49929304 GTGACTCCTTGTCAGTGGCCAGG + Intergenic
1152737360 17:82004121-82004143 GAGACCTCTGGGCAGTGTCCCGG + Intronic
1156273639 18:35560545-35560567 GTCACCTCTGGTCCTTCTCCAGG - Intergenic
1161291568 19:3496518-3496540 GTGAGCACCTGTCTGTGTCCCGG - Intronic
1161595462 19:5148957-5148979 GTTGCCTCTGGGCCGTGTCCTGG - Intronic
1167670494 19:50850247-50850269 GTGGCCTGATGTCCCTGTCCTGG + Intergenic
1168287024 19:55340215-55340237 CTGACCTCTTGTCACTCTCCAGG + Intronic
1168407222 19:56117005-56117027 CTGTCCTCTTGTCCCTGTGCTGG - Intronic
1168522405 19:57062769-57062791 GTGACCTCTTTAGAGTGTCCTGG - Intergenic
925582387 2:5424654-5424676 TTAACCTGTTCTCCGTGTCCAGG - Intergenic
928032484 2:27793477-27793499 GTGACCTTGTGTCCTTCTCCAGG - Intronic
934113700 2:88765171-88765193 GCGACCCCTGGTCCGTGTGCTGG - Intergenic
936079004 2:109419517-109419539 GTCCCCTCTTGTCTGTTTCCAGG + Exonic
948955615 2:241288110-241288132 GTGTCCTCTTTTCCCTCTCCAGG - Intronic
1169196759 20:3687334-3687356 GTGAGCTCCTGTCCTTTTCCTGG - Exonic
1169547675 20:6667280-6667302 GTCACCTCTTGTCCTTGTTCAGG - Intergenic
1170194316 20:13674792-13674814 GTTACCTCTTTCACGTGTCCAGG - Intergenic
1173352808 20:42260698-42260720 GTAACCTGTTCTCAGTGTCCCGG - Intronic
1176260608 20:64177653-64177675 GTACCCTCTTGTCCCTGCCCTGG - Intronic
1178756046 21:35350778-35350800 GTTACCTCTTGTCCTTTTTCTGG + Intronic
1179125834 21:38589681-38589703 GTGACCTCTTCTCATGGTCCTGG - Intronic
1180784773 22:18540766-18540788 GGGGCCTCTGGTCCTTGTCCAGG + Intergenic
1181128353 22:20714821-20714843 GGGGCCTCTGGTCCTTGTCCAGG + Intronic
1181241677 22:21480123-21480145 GGGGCCTCTGGTCCTTGTCCAGG + Intergenic
961367761 3:126412061-126412083 GGGACCGCTTTTCTGTGTCCTGG + Intronic
963145988 3:141995332-141995354 GTGACCTCATGTCAGTATTCAGG - Intronic
968868949 4:3231498-3231520 GTGAGCACATGTCCGTGACCTGG + Intronic
970408255 4:15784096-15784118 GTGACCTCTTGGCTGTGTACAGG - Intronic
972066558 4:34953246-34953268 CTGAGCTCTTGTCTGTGTCCAGG - Intergenic
985089727 4:186350673-186350695 GTGACCTCCTCTCAGTGTCCAGG + Intergenic
985652873 5:1115177-1115199 ATGGCCTCTTGGCCGTGTGCAGG + Intergenic
986199671 5:5569765-5569787 GTGACCTCCTTTCAGTGTTCTGG - Intergenic
988346406 5:30042555-30042577 CTGAATTCTTGTCCATGTCCAGG - Intergenic
989719919 5:44513645-44513667 GTGACCTCTTGTTCAAATCCTGG + Intergenic
993360965 5:86975859-86975881 GTTATCTCTTGTACGTGTCAGGG + Intergenic
998170935 5:139871611-139871633 GGGACCTCTTGTCAGTGGCTTGG + Intronic
998538456 5:142956236-142956258 AGGACATCTTGTCTGTGTCCTGG + Intronic
1002185387 5:177452344-177452366 GTGAGCTCTTGCCCTTGTCTGGG - Intronic
1002857111 6:1047830-1047852 GTGACCTGTGGTCAGTTTCCTGG - Intergenic
1006273658 6:32983684-32983706 GTCACCTCTGGTCCTTGTCCTGG - Intergenic
1019427997 7:986425-986447 GAAACCCCCTGTCCGTGTCCCGG - Intronic
1028621976 7:92835697-92835719 GTGGCCTCTTGTCGCTGTGCTGG - Intronic
1035865499 8:3077269-3077291 GTGGCCTTTTGTCCATGTCTTGG - Intronic
1036384668 8:8268792-8268814 CTGACTTCTTGTCAGTGTGCTGG - Intergenic
1036739570 8:11348103-11348125 GAGACCTCGTGTCCTAGTCCTGG + Intergenic
1059040231 9:110806872-110806894 GTGACCTCTTTTCCGTGGGATGG + Intergenic
1196969114 X:121089548-121089570 GTCACCTATTGTCCCTGGCCTGG + Intergenic
1197891615 X:131275303-131275325 GTGACCTCTTCTCTTTGACCAGG - Intronic