ID: 1067821502

View in Genome Browser
Species Human (GRCh38)
Location 10:49535021-49535043
Sequence CTGGGGCCCAAGAAATATCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067821496_1067821502 30 Left 1067821496 10:49534968-49534990 CCCGGGACACGGACAAGAGGTCA 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1067821502 10:49535021-49535043 CTGGGGCCCAAGAAATATCACGG No data
1067821497_1067821502 29 Left 1067821497 10:49534969-49534991 CCGGGACACGGACAAGAGGTCAC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1067821502 10:49535021-49535043 CTGGGGCCCAAGAAATATCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067821502 Original CRISPR CTGGGGCCCAAGAAATATCA CGG Intronic
No off target data available for this crispr