ID: 1067824228

View in Genome Browser
Species Human (GRCh38)
Location 10:49558323-49558345
Sequence CTGTGTGGAGTGAGGTAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067824224_1067824228 26 Left 1067824224 10:49558274-49558296 CCTTTTTGCACAGTTTTCTATGC No data
Right 1067824228 10:49558323-49558345 CTGTGTGGAGTGAGGTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067824228 Original CRISPR CTGTGTGGAGTGAGGTAAGC TGG Intergenic
No off target data available for this crispr