ID: 1067824837

View in Genome Browser
Species Human (GRCh38)
Location 10:49563316-49563338
Sequence ATAAAGAAGCCCCTTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067824837_1067824843 24 Left 1067824837 10:49563316-49563338 CCCTCCTCAAGGGGCTTCTTTAT No data
Right 1067824843 10:49563363-49563385 ATTGCCTTAGATCTAGAAATGGG No data
1067824837_1067824842 23 Left 1067824837 10:49563316-49563338 CCCTCCTCAAGGGGCTTCTTTAT No data
Right 1067824842 10:49563362-49563384 AATTGCCTTAGATCTAGAAATGG No data
1067824837_1067824844 25 Left 1067824837 10:49563316-49563338 CCCTCCTCAAGGGGCTTCTTTAT No data
Right 1067824844 10:49563364-49563386 TTGCCTTAGATCTAGAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067824837 Original CRISPR ATAAAGAAGCCCCTTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr