ID: 1067834390

View in Genome Browser
Species Human (GRCh38)
Location 10:49629152-49629174
Sequence CCTTATAGGCAGTGGGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067834390_1067834398 -9 Left 1067834390 10:49629152-49629174 CCTCCTACCCACTGCCTATAAGG 0: 1
1: 0
2: 1
3: 11
4: 169
Right 1067834398 10:49629166-49629188 CCTATAAGGTCAGAAGGACAGGG No data
1067834390_1067834396 -10 Left 1067834390 10:49629152-49629174 CCTCCTACCCACTGCCTATAAGG 0: 1
1: 0
2: 1
3: 11
4: 169
Right 1067834396 10:49629165-49629187 GCCTATAAGGTCAGAAGGACAGG No data
1067834390_1067834400 6 Left 1067834390 10:49629152-49629174 CCTCCTACCCACTGCCTATAAGG 0: 1
1: 0
2: 1
3: 11
4: 169
Right 1067834400 10:49629181-49629203 GGACAGGGGCCTTGTCTGTTTGG No data
1067834390_1067834399 -8 Left 1067834390 10:49629152-49629174 CCTCCTACCCACTGCCTATAAGG 0: 1
1: 0
2: 1
3: 11
4: 169
Right 1067834399 10:49629167-49629189 CTATAAGGTCAGAAGGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067834390 Original CRISPR CCTTATAGGCAGTGGGTAGG AGG (reversed) Intronic
904287718 1:29462727-29462749 CCTTGTGAGTAGTGGGTAGGAGG + Intergenic
906345642 1:45012741-45012763 CCTGATAGGCAGAGAGGAGGCGG + Intronic
906567947 1:46813890-46813912 CCTGCTAAGCAGAGGGTAGGAGG - Exonic
908032424 1:60015667-60015689 CCTTATAGGAAGTGGGCATTTGG - Intronic
909958196 1:81802829-81802851 CCTTCTCGTCAGTGGTTAGGTGG + Intronic
913195743 1:116454708-116454730 GATTCAAGGCAGTGGGTAGGGGG + Intergenic
918100822 1:181372489-181372511 CCTTTTAGGCAGAGACTAGGGGG + Intergenic
918139746 1:181710207-181710229 CCATAAAGCCAGTGGGAAGGTGG - Intronic
921564882 1:216704796-216704818 CATTTTGGGCTGTGGGTAGGGGG - Intronic
924772122 1:247087854-247087876 CCTGGTGGGCAGTGGGTATGTGG - Intergenic
1067834390 10:49629152-49629174 CCTTATAGGCAGTGGGTAGGAGG - Intronic
1068351071 10:55845921-55845943 CCTCCTAGGCAGTGTGTGGGGGG - Intergenic
1069869524 10:71524688-71524710 CCTTATAAGAAGCAGGTAGGAGG + Intronic
1071799601 10:89043825-89043847 GCTTACAGGGAGAGGGTAGGTGG - Intergenic
1073186596 10:101618807-101618829 CCTGATAGCCTGTGGGCAGGTGG - Intronic
1073301090 10:102471291-102471313 GCTTGTAGGCAGTGAGGAGGCGG + Exonic
1073646930 10:105314580-105314602 CTTTAGAGCCAGTTGGTAGGTGG + Intergenic
1073979154 10:109134395-109134417 CATTAAAAGCAGTGGGTAGAGGG + Intergenic
1076178041 10:128383696-128383718 CCTGAGAGCCAGTGGGTGGGAGG + Intergenic
1077336368 11:2006675-2006697 CCTTATAGGAAGAGGAGAGGAGG + Intergenic
1079479670 11:20866049-20866071 CCTTGAAGGCAGGGGGCAGGAGG - Intronic
1083687292 11:64384242-64384264 CCTCCTAGGCAGAGGGCAGGAGG + Intergenic
1083792109 11:64992558-64992580 CCTTATAAGAAGAGGGAAGGAGG + Intronic
1084286382 11:68133908-68133930 CATGACAGGAAGTGGGTAGGGGG + Intergenic
1086087759 11:82972117-82972139 GCTTATCTGCAGTTGGTAGGAGG - Intergenic
1088759109 11:112912676-112912698 CCTTGTATGCAGTGGTAAGGAGG + Intergenic
1089257273 11:117200530-117200552 CCTTCGAGCCAGTGGGGAGGGGG - Intronic
1090003712 11:122982390-122982412 AGTTATAGGCAGTGGGCAGGAGG + Intergenic
1202819352 11_KI270721v1_random:61857-61879 CCTTATAGGAAGAGGAGAGGAGG + Intergenic
1092835858 12:12487702-12487724 CCTGATAGTCAGTAGGTAGTTGG - Intronic
1092926419 12:13276300-13276322 CCTTTTGGGAAGTGGGTGGGTGG + Intergenic
1094005842 12:25750304-25750326 CCTTATAGGAAGGGGGTGAGAGG + Intergenic
1094036260 12:26075214-26075236 CCTTTAAGGCTGTGGGTAAGTGG - Intronic
1097689856 12:62724526-62724548 CCTCAGAGGGAGAGGGTAGGTGG - Intronic
1098467110 12:70800230-70800252 TCTAAAATGCAGTGGGTAGGGGG - Intronic
1101328316 12:103736290-103736312 CTTTCCAGGCAGTGGGAAGGAGG + Intronic
1101468188 12:104969521-104969543 ACTGATAGGCAGTGTGTAGGTGG + Intergenic
1102497860 12:113331889-113331911 CCTTACAGGCTGCGGCTAGGAGG - Intronic
1103593825 12:122010948-122010970 TCATATGGGAAGTGGGTAGGTGG + Intergenic
1104163807 12:126206471-126206493 CCTTCTTTGCAGTGAGTAGGTGG + Intergenic
1104470883 12:129028745-129028767 CCTAACAGGGAGTGGATAGGGGG - Intergenic
1106602958 13:31202752-31202774 CTTAATAGGCAATGGGAAGGAGG - Intronic
1106987994 13:35378445-35378467 CTTTATAAGCAGTGGCTAAGTGG - Intronic
1107246531 13:38303276-38303298 CCTTGCAGATAGTGGGTAGGGGG - Intergenic
1108630517 13:52277258-52277280 TCTTATAGGCAGTATGTAGTTGG + Intergenic
1108656174 13:52535264-52535286 TCTTATAGGCAGTATGTAGTTGG - Intergenic
1109499955 13:63221474-63221496 GTTTATAGGCTGGGGGTAGGGGG + Intergenic
1110242111 13:73280762-73280784 CCTTGTGGGAAGTGGGTTGGGGG + Intergenic
1112979351 13:105362776-105362798 TTATATAGGCAGTGGGGAGGAGG + Intergenic
1114483085 14:23047395-23047417 CGTTAGAGGCAGTGGGGAGTGGG + Intronic
1116269324 14:42741422-42741444 CCTTGCAGGCAGGGGGTGGGGGG - Intergenic
1116712296 14:48383645-48383667 CCTTATAGGCACAGGATGGGGGG + Intergenic
1117526509 14:56611975-56611997 ACTTAAGGGCAGAGGGTAGGAGG + Intronic
1121260999 14:92566063-92566085 CCTTTGAGGCACTGGGTTGGTGG + Intronic
1122488010 14:102094673-102094695 CCTTCAGTGCAGTGGGTAGGGGG + Intronic
1124136282 15:27038743-27038765 CCAGAAAGGCAGAGGGTAGGGGG + Intronic
1124166529 15:27331090-27331112 CCTTAAATGCAGTGGGGATGTGG + Intronic
1130359005 15:83163312-83163334 TCTTGCAGGCAGTGGGAAGGAGG - Intronic
1132427623 15:101732123-101732145 CCTTAAATGGAGTGGGGAGGTGG - Intergenic
1133428686 16:5716589-5716611 GCTTATATGCTGTTGGTAGGAGG + Intergenic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1134060557 16:11197258-11197280 TCTTATAGGCAGTGGGTACTGGG - Intergenic
1135421229 16:22306966-22306988 CCTTATGGGCCGTGGGAATGGGG + Intronic
1137509891 16:49090013-49090035 GCTGATAGGAAGTGGGTATGGGG - Intergenic
1138481432 16:57305815-57305837 CCTGATAGGCAGGGAGTAGAGGG + Intergenic
1138724236 16:59118502-59118524 CCTTGTCTGCAGTGGGTGGGTGG + Intergenic
1139188270 16:64832854-64832876 CCTTAAAGGCAGCCGGGAGGGGG + Intergenic
1139508212 16:67410181-67410203 CTTTCTAGCCAGTGGGGAGGAGG + Intronic
1141056197 16:80816937-80816959 CCTTGGGGACAGTGGGTAGGAGG - Intergenic
1142613452 17:1121797-1121819 CCTGAAAGGTAGTGGGGAGGAGG - Intronic
1147437775 17:40428216-40428238 CATTAGAGGCAGTAGGGAGGAGG + Intergenic
1148484586 17:47982488-47982510 GCTGAAAGGCAGTGGGGAGGGGG - Intergenic
1148694724 17:49552029-49552051 CCAGACAGGCTGTGGGTAGGGGG - Intergenic
1148804920 17:50259214-50259236 CCTTCTAGGGACTGGGGAGGTGG - Intergenic
1149640744 17:58200813-58200835 CCTTAGAGGCAGGGAATAGGTGG + Intronic
1150781070 17:68122581-68122603 CTTTATAGGATTTGGGTAGGTGG + Intergenic
1150860440 17:68795727-68795749 TCTTAAGGGCAGTGGGTGGGGGG + Intergenic
1154053418 18:10985959-10985981 CCTTGTAGGCAGTGTATAGCTGG - Intronic
1155405007 18:25478171-25478193 GCTTATAGGGAGTAGGTAGTTGG - Intergenic
1157601725 18:48897134-48897156 CCTTCCAGACAGTGGGGAGGAGG + Intergenic
1157979534 18:52364782-52364804 GCTTAGAGGCAGTGAGGAGGTGG + Intronic
1159246159 18:65807968-65807990 CGTTATAGGGAGTGGGGATGTGG + Intronic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
929585920 2:43114345-43114367 GCTTATAGGCAGGTGGTGGGAGG - Intergenic
929780348 2:44953121-44953143 CCTCCTAGGCAGCGCGTAGGAGG - Intergenic
930522239 2:52482034-52482056 CCATAGAGGCAGAGGGTAGAAGG + Intergenic
932225954 2:70040934-70040956 GCTTATAGGAAGTGGGAAGAGGG - Intergenic
932844614 2:75122575-75122597 TCTTTTAGAAAGTGGGTAGGTGG + Intronic
933751522 2:85604996-85605018 CTTCATAGGTAGTTGGTAGGGGG + Intronic
941007582 2:160263369-160263391 CCTCATGGGCAGTGGGGAGCTGG - Intronic
945202436 2:207296156-207296178 CTTAATAGAAAGTGGGTAGGAGG - Intergenic
945371805 2:209027788-209027810 CTTTAAAGGCAGTAGGTAAGTGG + Intergenic
946366867 2:219253941-219253963 CCTTATAGGCGGGGGGGGGGCGG + Exonic
948155236 2:235776302-235776324 CCGAATGGGCAGTAGGTAGGGGG - Intronic
948644750 2:239397503-239397525 CCTTCCAGGAAGTGAGTAGGAGG + Intronic
948644765 2:239397572-239397594 CCTTCTAGGAAGTGAGTAGGAGG + Intronic
1172726959 20:37051856-37051878 TCTTATAGTCAGTGTGTAGTTGG - Intronic
1172758530 20:37305518-37305540 TCTAAATGGCAGTGGGTAGGGGG - Intronic
1175765939 20:61592993-61593015 CCTTATAGGAGGGGGGCAGGAGG + Intronic
1176607112 21:8842616-8842638 CCTAATAGCAAGTGGGGAGGAGG - Intergenic
1178990819 21:37355079-37355101 CCTGATAGAGAGTGGGGAGGAGG - Intergenic
1179398020 21:41059158-41059180 CCTTATAGGAAGAAAGTAGGAGG - Intergenic
1183631971 22:39039014-39039036 CTTTATAGGACTTGGGTAGGTGG + Intergenic
1183637854 22:39075842-39075864 CTTTATAGGACTTGGGTAGGCGG + Intronic
1184464953 22:44663527-44663549 CCTTATAAGAGGTGGGCAGGAGG - Intergenic
1184841928 22:47057152-47057174 CATTTTAGGAAGTCGGTAGGTGG + Intronic
1184960135 22:47922653-47922675 GCCCATAGGCAGTGGGCAGGTGG + Intergenic
949419225 3:3847840-3847862 CCTAATGGGCAGTGGGAGGGTGG + Intronic
951526828 3:23661359-23661381 TCATATAGTGAGTGGGTAGGAGG + Intergenic
953399635 3:42601150-42601172 CCTTTTTGGGAGCGGGTAGGAGG + Intronic
956759086 3:72421986-72422008 CCTTATAGGCAGTATGTAGTTGG - Intronic
959308009 3:104694122-104694144 CCTTCAAAGCAGTGGGTAGAGGG - Intergenic
963925097 3:150943360-150943382 ATTTATAGGCAGAGGATAGGTGG - Intronic
966516159 3:180822903-180822925 CCTTGAAGGCAGAGGGTGGGAGG + Intronic
967524544 3:190475379-190475401 TCTTGTAGGCAGTGTGTAGTTGG - Intergenic
969038215 4:4273220-4273242 CCTTAAAGACAGTGGGTGAGAGG + Intronic
969295360 4:6267373-6267395 CCTTATTGGTGGTGGGGAGGGGG - Intergenic
971439945 4:26673545-26673567 CCTTATCCACACTGGGTAGGAGG + Intronic
971473420 4:27050721-27050743 CCATATAGGCTGTGGGAAGTGGG - Intergenic
972612429 4:40668137-40668159 CCTTAAAGGCAATGGTTAGGGGG - Intergenic
973261373 4:48167735-48167757 TGTGATATGCAGTGGGTAGGTGG - Intronic
973390018 4:49546857-49546879 CCTAATAGCAAGTGGGGAGGAGG - Intergenic
975492278 4:75002345-75002367 GCTTATAGGAGGTGGGTAGAAGG + Intronic
975594533 4:76036726-76036748 CATTATAGGCAGATGGCAGGGGG + Intronic
976992633 4:91386615-91386637 ACTTATTGGCAGTCTGTAGGAGG - Intronic
977497650 4:97798334-97798356 CATTTAAGGCAGTGGGTAGAGGG - Intronic
980096897 4:128501085-128501107 GCTCATAGGGAGTGGGCAGGGGG - Intergenic
980129239 4:128803202-128803224 CCTGATGGGCAGTGAGTAGGTGG - Intergenic
982102798 4:151984812-151984834 GCATATAGGCGGTGGGGAGGGGG - Intergenic
983421690 4:167526710-167526732 CCTCATAGGCAGTGCCTATGAGG - Intergenic
983538387 4:168882228-168882250 CCTCATAGGAAACGGGTAGGTGG + Intronic
984531029 4:180916462-180916484 CCATATAGGCACTGGGGATGTGG + Intergenic
984709759 4:182875393-182875415 CCTTTTAGCCACTGGGAAGGGGG + Intergenic
989623259 5:43405486-43405508 CATTTTAAGCAGTGTGTAGGGGG + Intronic
992165824 5:74050369-74050391 ACTTATAGGCAGTGGGGACATGG - Intergenic
992205902 5:74430074-74430096 CTTTATAGGCACAGGATAGGAGG - Intergenic
992903138 5:81318952-81318974 CCTAATAGCCACTGGGGAGGTGG - Intergenic
997579892 5:135010628-135010650 GCTGATGGGCAGTGGGTGGGTGG + Intronic
998578086 5:143339707-143339729 CCTTCTAGGCTGAGGGTTGGTGG + Intronic
998814869 5:146002902-146002924 CCTCAGATGCAGGGGGTAGGAGG - Intronic
999446011 5:151639967-151639989 CCTTATAAGAGGTGGGTAGAGGG - Intergenic
1000154358 5:158535996-158536018 CCTTACTGTCAGTGGGTAGAAGG - Intergenic
1005073523 6:21885057-21885079 CTTGATAGGCAGTTGGTAGTGGG + Intergenic
1006738857 6:36293342-36293364 CCGGCTTGGCAGTGGGTAGGTGG - Intronic
1008493427 6:52109078-52109100 CTTTATAGCCAGTTGGTAGATGG + Intergenic
1009699024 6:67151087-67151109 CATTATGGGAAGTGGGTAGGAGG + Intergenic
1010643947 6:78364648-78364670 CTTTATAGGCACAGGTTAGGGGG - Intergenic
1011408761 6:87044020-87044042 CTTTATAGGCACAGGATAGGGGG - Intergenic
1013624082 6:111919993-111920015 CCTTAAACCCAGTGGGAAGGAGG - Intergenic
1018520052 6:164639121-164639143 CCTTGAGGGCAGAGGGTAGGAGG - Intergenic
1019091512 6:169539217-169539239 TCTTATAGGCAGTGGACAGAAGG - Intronic
1020087009 7:5315962-5315984 TCTTATAGTCAGGGGGCAGGAGG + Exonic
1020803062 7:12756042-12756064 GCTTATGGGGAGTGGGTGGGTGG + Intergenic
1021751341 7:23803731-23803753 ACTTAAGGGCAGAGGGTAGGAGG - Intronic
1023404459 7:39817674-39817696 CCTGATTGGCAGTGAATAGGTGG + Intergenic
1025207297 7:57001191-57001213 TCTTATAGTCAGGGGGCAGGAGG - Intergenic
1025664640 7:63575695-63575717 TCTTATAGTCAGGGGGCAGGAGG + Intergenic
1030872888 7:114779392-114779414 CCTTGTAGGGGGTGGGAAGGAGG - Intergenic
1031290048 7:119922994-119923016 CCTTATAAGCACTGTGGAGGTGG - Intergenic
1032529126 7:132605516-132605538 CCTGTTAGGAAGTGGGTAGGTGG + Intronic
1033994598 7:147330144-147330166 CCTTCTAGGAGGTTGGTAGGTGG - Intronic
1042521013 8:69711130-69711152 CCCAATAGGGAGTGGGCAGGCGG - Intronic
1048511812 8:135069901-135069923 TTTTATAGGCACAGGGTAGGGGG - Intergenic
1049473483 8:142786562-142786584 CCTTATAGGCACGGGCTGGGCGG + Exonic
1049684662 8:143934470-143934492 CCCTATAGGCAGGGGGCAGGGGG + Intronic
1051556272 9:18385853-18385875 AGTTATAGGCAGTGGGTGGCAGG + Intergenic
1052992234 9:34525546-34525568 CGCTATGGGCAGTGGGGAGGTGG + Intergenic
1058115239 9:101077757-101077779 CCTTATATGACCTGGGTAGGGGG + Intronic
1058131100 9:101254490-101254512 CCTGATAGGAACTGGGCAGGAGG - Intronic
1058364194 9:104188388-104188410 CTTTATTGCCACTGGGTAGGAGG + Intergenic
1061428027 9:130513067-130513089 CCTTATAGCCAGGGGGTAGGAGG - Intergenic
1203554425 Un_KI270743v1:193563-193585 CCTAATAGCAAGTGGGGAGGAGG - Intergenic
1185804475 X:3044798-3044820 CCTTATGGGCACAGGATAGGGGG + Intronic
1187441416 X:19323979-19324001 TGTTATACGCAGTGGGGAGGAGG + Intergenic
1188985123 X:36762228-36762250 CCTGATAGGCAGTGCCTGGGTGG - Intergenic
1189991267 X:46597438-46597460 CCTTCTGGGTAGTGTGTAGGAGG - Intronic
1190395206 X:49975440-49975462 CCTTATAGGAAGAGGGTAAATGG - Intronic
1192533971 X:71912026-71912048 CCCTAGCGGTAGTGGGTAGGGGG - Intergenic
1193338865 X:80322419-80322441 CATTTTAAGCAGTGGGTAGAGGG + Intergenic
1194651980 X:96526503-96526525 CTTTATAGGCAGTGTGTTTGTGG - Intergenic
1197451788 X:126628687-126628709 GCTTATAGGCAGTGGGTACTTGG - Intergenic
1198241135 X:134787000-134787022 GATTATAGGCAGTGGGTATATGG + Intronic