ID: 1067834973

View in Genome Browser
Species Human (GRCh38)
Location 10:49632820-49632842
Sequence CATGAGGCCCACAGGGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067834968_1067834973 -2 Left 1067834968 10:49632799-49632821 CCTCTGCCACGACACTGAGGGCA 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1067834973 10:49632820-49632842 CATGAGGCCCACAGGGTTCCAGG No data
1067834967_1067834973 -1 Left 1067834967 10:49632798-49632820 CCCTCTGCCACGACACTGAGGGC 0: 1
1: 0
2: 1
3: 26
4: 537
Right 1067834973 10:49632820-49632842 CATGAGGCCCACAGGGTTCCAGG No data
1067834964_1067834973 4 Left 1067834964 10:49632793-49632815 CCTGACCCTCTGCCACGACACTG 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1067834973 10:49632820-49632842 CATGAGGCCCACAGGGTTCCAGG No data
1067834970_1067834973 -8 Left 1067834970 10:49632805-49632827 CCACGACACTGAGGGCATGAGGC 0: 1
1: 0
2: 0
3: 11
4: 93
Right 1067834973 10:49632820-49632842 CATGAGGCCCACAGGGTTCCAGG No data
1067834963_1067834973 17 Left 1067834963 10:49632780-49632802 CCAGGCTGCTTAGCCTGACCCTC 0: 1
1: 0
2: 2
3: 22
4: 255
Right 1067834973 10:49632820-49632842 CATGAGGCCCACAGGGTTCCAGG No data
1067834960_1067834973 27 Left 1067834960 10:49632770-49632792 CCTGTGAGCCCCAGGCTGCTTAG 0: 1
1: 0
2: 3
3: 24
4: 190
Right 1067834973 10:49632820-49632842 CATGAGGCCCACAGGGTTCCAGG No data
1067834959_1067834973 30 Left 1067834959 10:49632767-49632789 CCTCCTGTGAGCCCCAGGCTGCT 0: 1
1: 1
2: 11
3: 44
4: 424
Right 1067834973 10:49632820-49632842 CATGAGGCCCACAGGGTTCCAGG No data
1067834962_1067834973 18 Left 1067834962 10:49632779-49632801 CCCAGGCTGCTTAGCCTGACCCT 0: 1
1: 0
2: 0
3: 12
4: 258
Right 1067834973 10:49632820-49632842 CATGAGGCCCACAGGGTTCCAGG No data
1067834961_1067834973 19 Left 1067834961 10:49632778-49632800 CCCCAGGCTGCTTAGCCTGACCC 0: 1
1: 0
2: 1
3: 22
4: 210
Right 1067834973 10:49632820-49632842 CATGAGGCCCACAGGGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067834973 Original CRISPR CATGAGGCCCACAGGGTTCC AGG Intronic
No off target data available for this crispr