ID: 1067837694

View in Genome Browser
Species Human (GRCh38)
Location 10:49651734-49651756
Sequence ACACCTCAGTGCACTCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067837691_1067837694 22 Left 1067837691 10:49651689-49651711 CCTGGTTTGTCTTCTGACACTTT 0: 1
1: 0
2: 0
3: 30
4: 287
Right 1067837694 10:49651734-49651756 ACACCTCAGTGCACTCCTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 115
1067837690_1067837694 27 Left 1067837690 10:49651684-49651706 CCTGGCCTGGTTTGTCTTCTGAC 0: 1
1: 0
2: 2
3: 27
4: 353
Right 1067837694 10:49651734-49651756 ACACCTCAGTGCACTCCTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067837694 Original CRISPR ACACCTCAGTGCACTCCTGA AGG Intronic