ID: 1067838046

View in Genome Browser
Species Human (GRCh38)
Location 10:49653699-49653721
Sequence TGCAGGACCTGCCTGGCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067838044_1067838046 -8 Left 1067838044 10:49653684-49653706 CCAGTACTGAGATGCTGCAGGAC 0: 1
1: 0
2: 1
3: 12
4: 115
Right 1067838046 10:49653699-49653721 TGCAGGACCTGCCTGGCATTTGG No data
1067838042_1067838046 -3 Left 1067838042 10:49653679-49653701 CCTCACCAGTACTGAGATGCTGC 0: 1
1: 0
2: 1
3: 11
4: 140
Right 1067838046 10:49653699-49653721 TGCAGGACCTGCCTGGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067838046 Original CRISPR TGCAGGACCTGCCTGGCATT TGG Intronic
No off target data available for this crispr