ID: 1067838288

View in Genome Browser
Species Human (GRCh38)
Location 10:49655140-49655162
Sequence CCACGCGTCCCTCCTGGAAT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067838288_1067838292 4 Left 1067838288 10:49655140-49655162 CCGATTCCAGGAGGGACGCGTGG 0: 1
1: 0
2: 1
3: 8
4: 98
Right 1067838292 10:49655167-49655189 CATCAGATCGGCCACTCCAGAGG 0: 1
1: 0
2: 1
3: 3
4: 61
1067838288_1067838293 10 Left 1067838288 10:49655140-49655162 CCGATTCCAGGAGGGACGCGTGG 0: 1
1: 0
2: 1
3: 8
4: 98
Right 1067838293 10:49655173-49655195 ATCGGCCACTCCAGAGGCACTGG 0: 1
1: 0
2: 0
3: 7
4: 120
1067838288_1067838291 -8 Left 1067838288 10:49655140-49655162 CCGATTCCAGGAGGGACGCGTGG 0: 1
1: 0
2: 1
3: 8
4: 98
Right 1067838291 10:49655155-49655177 ACGCGTGGACAACATCAGATCGG 0: 1
1: 0
2: 0
3: 2
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067838288 Original CRISPR CCACGCGTCCCTCCTGGAAT CGG (reversed) Exonic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
900592667 1:3466971-3466993 CCACAAGTCCCACCTGAAATGGG - Intronic
901626672 1:10628875-10628897 TCCCAGGTCCCTCCTGGAATTGG + Intronic
902578311 1:17392433-17392455 ACACGTGTCCATTCTGGAATGGG - Intronic
907251432 1:53142266-53142288 CCACACGCCCCTCCTGGACAGGG + Intronic
913022751 1:114804460-114804482 CCCCGCCTCCCTCCTGGACGGGG + Intergenic
923493102 1:234501684-234501706 CCATCCATCCCTCCTGGCATTGG - Intergenic
924800297 1:247324904-247324926 CCACTCTTCTCTCCTGGAATTGG + Intronic
1067838288 10:49655140-49655162 CCACGCGTCCCTCCTGGAATCGG - Exonic
1069615897 10:69806059-69806081 CCCTGCCTCCCTCCTGGGATTGG + Intronic
1070138349 10:73715607-73715629 CCCCACCTCCCTCCTGGAAGGGG + Intergenic
1070966666 10:80534647-80534669 CCCCGCCTCCCTCCTGGACGGGG - Intergenic
1072219418 10:93315234-93315256 CCAGGGGTCCCTCCTGGCAGAGG - Intronic
1075227664 10:120644283-120644305 CCTGGCTTCCCTCCTGGTATTGG + Intergenic
1075233914 10:120709576-120709598 CCATGCCAGCCTCCTGGAATAGG - Intergenic
1075842796 10:125518539-125518561 CCCCACCTCCCTCCTGGAAGGGG - Intergenic
1076889745 10:133277638-133277660 CCAGGCCGCCCTCCTGGAGTGGG + Intergenic
1079368620 11:19831205-19831227 CCCCGCAACACTCCTGGAATGGG - Intronic
1080887118 11:36377176-36377198 CCACGCCTCCCTCCAGAAAAAGG - Intronic
1081921051 11:46777397-46777419 CCATGCCTCCATTCTGGAATAGG - Intronic
1086632214 11:89036224-89036246 CCACGCTTTCCTCCTCCAATTGG - Intronic
1093453355 12:19340347-19340369 CCCCGCCTCCCTCCTGGACGGGG - Intronic
1094131179 12:27077245-27077267 CCACCCGTCCATCTTGAAATTGG + Intergenic
1094180627 12:27589093-27589115 CCACCCGTCCATCTTGAAATTGG + Intronic
1094778169 12:33757035-33757057 CCCTGCCTCGCTCCTGGAATTGG + Intergenic
1096470015 12:51869759-51869781 CCACGCCTCCCACCTTGTATAGG - Intergenic
1101135448 12:101739117-101739139 CGCCGCGTCCCTCCTGTAAGTGG + Intronic
1102294013 12:111723426-111723448 CCCCGCCTCCCTCCTGGACGGGG + Intronic
1104838682 12:131809221-131809243 CGACGCGTCCCTCCTGCCCTGGG - Intergenic
1104898075 12:132173906-132173928 CCATGTGTCCCTCCGGCAATGGG + Intergenic
1106465876 13:30014120-30014142 CCACCCCAGCCTCCTGGAATGGG + Intergenic
1107499137 13:40955881-40955903 CCCCGCCTCCCTCCTGGATGGGG - Intronic
1111418328 13:87976646-87976668 CCCCACCTCCCTCCTGGACTGGG + Intergenic
1114070131 14:19099134-19099156 CCACGCCTTCCTCCTGGGATGGG + Intergenic
1114092132 14:19300868-19300890 CCACGCCTTCCTCCTGGGATGGG - Intergenic
1114199326 14:20506647-20506669 CCCCACCTCCCTCCTGGACTGGG - Intronic
1127700198 15:61492138-61492160 CCACAGATCCCTCCTGGAAAAGG + Intergenic
1130671251 15:85914824-85914846 CCAAGCATCCCACCTGGACTGGG - Intergenic
1132975880 16:2711012-2711034 CCTCGAGTCCCTCCTGGAGCTGG + Intergenic
1145263875 17:21370205-21370227 CCACGTCTCCCGCCTGCAATGGG + Intergenic
1145920126 17:28604139-28604161 CCCCACCTCCCTCCTGGAAGGGG + Intronic
1152931826 17:83113929-83113951 CCCCGCGACCCTCCTTGAAGGGG + Intergenic
1155517305 18:26636715-26636737 CCAGGCTGCCCTCCTGGAAGAGG - Intronic
1157554835 18:48606631-48606653 CCTGTCGTCCCTCCTGGAGTGGG - Intronic
1157934734 18:51860404-51860426 CCACGCCTCCCTCGTGGAAAGGG + Intergenic
1158106258 18:53888335-53888357 CCACACCACCCTCCTGGAACTGG + Intergenic
1159586649 18:70288970-70288992 CCGCGCGCCCCTCCTGGAGGAGG + Exonic
1160077360 18:75691245-75691267 CCAGGCCTCCTTCCTGGATTGGG - Intergenic
1160843728 19:1157539-1157561 CCACGCATCCCTCCAGTCATGGG - Intronic
926224907 2:10960841-10960863 CCAGGCTTCCCTCCTGGGACCGG - Intergenic
934979162 2:98826056-98826078 TAACGCGTCCCCCCTGGAGTGGG - Intronic
937865815 2:126751346-126751368 CTTCGGGTCCCTCCTGGAACAGG - Intergenic
940628314 2:156205330-156205352 GCACTTGTCCCTCCTGGAAGTGG + Intergenic
942096215 2:172538067-172538089 CCACGCCTCCCTCCCGGACGGGG - Intergenic
944585123 2:201166266-201166288 CCACGCCTCCCTCCCGGACGGGG + Exonic
948878137 2:240841038-240841060 CCAAGGGTCCCTCCTGTAAACGG - Intergenic
1171430864 20:25082369-25082391 CCTCCCCTCCCTCCTAGAATGGG - Intergenic
1172721171 20:37000751-37000773 CCCCGCCTCCCTCCTGGACGGGG - Intronic
1174190303 20:48735651-48735673 GCACGCTGCTCTCCTGGAATGGG + Intronic
1178905412 21:36632229-36632251 GCACGTTTCCCACCTGGAATGGG - Intergenic
1180488602 22:15821696-15821718 CCACGCCTTCCTCCTGGGATGGG + Intergenic
1184852005 22:47126401-47126423 CCACGCTTCCCTCTTGTAACTGG + Intronic
949569962 3:5283863-5283885 CCCCGCCTCCCTCCTGGACGGGG + Intergenic
950694104 3:14684198-14684220 ACACGTGTCCCTCCTAGCATGGG - Intronic
952031236 3:29145027-29145049 AGACGCTTCTCTCCTGGAATAGG + Intergenic
952334377 3:32392035-32392057 CCACGCGGCCCTGCTGAAAGTGG + Exonic
954297128 3:49680531-49680553 CCACCTGACCCTCCTGGAAAAGG - Exonic
954443313 3:50533543-50533565 CCAGGCGACCCTCCTGGCAGGGG + Intergenic
954481280 3:50803797-50803819 CCCCACCTCCCTCCTGGAAGGGG + Intronic
960862161 3:122164862-122164884 CCACACCTCCCTCCTGGACGGGG - Intergenic
960945645 3:122964634-122964656 CCATGCCTCCCTCCTGGACAAGG + Intronic
966253447 3:177891764-177891786 CCACACCTCCCTCCTGGACGGGG + Intergenic
966891405 3:184409960-184409982 CCAGGCTTCCCTCCTGGAATAGG - Intronic
966904775 3:184514084-184514106 CCACGCCGCCCTCCTGGGAGGGG - Intronic
967177666 3:186874420-186874442 CCCCGCCTCCCTCCTGGATGGGG - Intergenic
974079103 4:57194620-57194642 CCACCCGGCCTTCCTGGAACTGG - Intergenic
980895260 4:138854496-138854518 CCCCACCTCCCTCCTGGACTGGG - Intergenic
989164845 5:38423899-38423921 TCACCCTTCCCTCCTTGAATTGG - Intronic
989667138 5:43867588-43867610 GCACAGGTCCCTCCTGGAGTGGG + Intergenic
1002693283 5:181065835-181065857 CCACGTTTCCCTCCTGCAAGCGG + Intergenic
1005158897 6:22836888-22836910 CCACACCTCCCTCCTGGACGGGG - Intergenic
1006434629 6:34019841-34019863 CCAGGCGTCCCTCCTGCCATGGG + Intronic
1008664784 6:53705481-53705503 CCAAGCCTCCCTCCTGGAACTGG - Intergenic
1009444336 6:63722753-63722775 CCACACCTCCCTCCTGCAAATGG + Intronic
1013530753 6:111017358-111017380 CCCCGCCTCCCTCCTGGACGGGG + Intronic
1014535677 6:122610573-122610595 CCACTCCTCCCTCCTCGCATAGG - Intronic
1016177182 6:141095490-141095512 CCACTTGTCACTCCTGGAACTGG - Intergenic
1016369816 6:143361849-143361871 CCAAGCCTCCCTCCTGGAGCTGG - Intergenic
1021735796 7:23637777-23637799 CCCCGCCTCCCTCCCGGACTGGG - Intronic
1025821348 7:64967620-64967642 CCCCGCCTCCCTCCTGGATGGGG + Intergenic
1027255981 7:76431013-76431035 ACAGGTGCCCCTCCTGGAATGGG + Intronic
1029456122 7:100673453-100673475 CCTCCCGCCCCGCCTGGAATGGG - Intergenic
1032492711 7:132335868-132335890 CCCCACTTCCCTCCTAGAATGGG - Intronic
1033050903 7:138003080-138003102 CCAGGCCTGCCTCCTAGAATAGG + Intronic
1035022912 7:155809478-155809500 CCACCCTTAACTCCTGGAATCGG + Intronic
1035742995 8:1943305-1943327 CCTCGCCCTCCTCCTGGAATGGG - Intronic
1037814138 8:22103004-22103026 CCACACTCCCCTCCTGGGATGGG + Exonic
1039885606 8:41652512-41652534 CCCAGCCTCTCTCCTGGAATCGG - Intergenic
1040785607 8:51159493-51159515 CCCCGCCTCCCTCCTGGATGGGG - Intergenic
1042134045 8:65616983-65617005 CCCCGCCTCCCTCCTGGATGGGG - Intronic
1050123547 9:2332749-2332771 ACACATGTCCCTCTTGGAATGGG + Intergenic
1058939244 9:109798078-109798100 CCAGGCCTCTCTCCTGGACTTGG + Intronic
1062436067 9:136547074-136547096 CCCGGCGCCCCTCCTGGAGTAGG + Intergenic
1189479644 X:41382759-41382781 CCTCTCCTACCTCCTGGAATTGG - Intergenic
1189968236 X:46395344-46395366 CCACACCTCCCTCCCGGACTGGG + Intergenic
1197703105 X:129614837-129614859 CCACTCATCCCTCCTGGGCTTGG + Intergenic
1197781666 X:130166016-130166038 CCACGAGTCCCTCCTTGAACAGG - Intergenic
1201305032 Y:12542610-12542632 CCACGCCTGCCTCCTAGAAGTGG - Intergenic