ID: 1067841063

View in Genome Browser
Species Human (GRCh38)
Location 10:49679804-49679826
Sequence CTCGCCGCGTGCGCCCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 32}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067841049_1067841063 26 Left 1067841049 10:49679755-49679777 CCGGTGGAGCACCACACCTTCCG 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1067841063 10:49679804-49679826 CTCGCCGCGTGCGCCCCTGAGGG 0: 1
1: 0
2: 0
3: 4
4: 32
1067841053_1067841063 10 Left 1067841053 10:49679771-49679793 CCTTCCGCCTGCAGGGCCTGCAA 0: 1
1: 0
2: 1
3: 20
4: 208
Right 1067841063 10:49679804-49679826 CTCGCCGCGTGCGCCCCTGAGGG 0: 1
1: 0
2: 0
3: 4
4: 32
1067841048_1067841063 30 Left 1067841048 10:49679751-49679773 CCTACCGGTGGAGCACCACACCT 0: 1
1: 0
2: 0
3: 8
4: 50
Right 1067841063 10:49679804-49679826 CTCGCCGCGTGCGCCCCTGAGGG 0: 1
1: 0
2: 0
3: 4
4: 32
1067841052_1067841063 15 Left 1067841052 10:49679766-49679788 CCACACCTTCCGCCTGCAGGGCC 0: 1
1: 0
2: 6
3: 35
4: 412
Right 1067841063 10:49679804-49679826 CTCGCCGCGTGCGCCCCTGAGGG 0: 1
1: 0
2: 0
3: 4
4: 32
1067841058_1067841063 3 Left 1067841058 10:49679778-49679800 CCTGCAGGGCCTGCAAGGTGGGC 0: 1
1: 0
2: 3
3: 29
4: 296
Right 1067841063 10:49679804-49679826 CTCGCCGCGTGCGCCCCTGAGGG 0: 1
1: 0
2: 0
3: 4
4: 32
1067841059_1067841063 -6 Left 1067841059 10:49679787-49679809 CCTGCAAGGTGGGCCTCCTCGCC 0: 1
1: 0
2: 2
3: 15
4: 139
Right 1067841063 10:49679804-49679826 CTCGCCGCGTGCGCCCCTGAGGG 0: 1
1: 0
2: 0
3: 4
4: 32
1067841055_1067841063 6 Left 1067841055 10:49679775-49679797 CCGCCTGCAGGGCCTGCAAGGTG 0: 1
1: 0
2: 0
3: 38
4: 315
Right 1067841063 10:49679804-49679826 CTCGCCGCGTGCGCCCCTGAGGG 0: 1
1: 0
2: 0
3: 4
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067841063 Original CRISPR CTCGCCGCGTGCGCCCCTGA GGG Intronic