ID: 1067841264

View in Genome Browser
Species Human (GRCh38)
Location 10:49681183-49681205
Sequence CTGATTCAGCACCTCTGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 310}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067841264_1067841266 16 Left 1067841264 10:49681183-49681205 CCTAGACAGAGGTGCTGAATCAG 0: 1
1: 0
2: 1
3: 29
4: 310
Right 1067841266 10:49681222-49681244 TTCAGAGAAAAAGTCTGAAATGG No data
1067841264_1067841265 -9 Left 1067841264 10:49681183-49681205 CCTAGACAGAGGTGCTGAATCAG 0: 1
1: 0
2: 1
3: 29
4: 310
Right 1067841265 10:49681197-49681219 CTGAATCAGCTCTGTTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067841264 Original CRISPR CTGATTCAGCACCTCTGTCT AGG (reversed) Intronic
900004230 1:34157-34179 CTGATGCAGCACCTGTGAATGGG - Intergenic
900023958 1:204673-204695 CTGATGCAGCACCTGTGAATGGG - Intergenic
901087007 1:6616804-6616826 CAAATTCTGCACCTTTGTCTTGG + Exonic
901184934 1:7366856-7366878 CTGATACAGCTCATCTGTCTGGG + Intronic
901560360 1:10065450-10065472 CATATTCACCACCCCTGTCTGGG + Intronic
902207763 1:14882034-14882056 CTGATTCAGTAGCTCTGGCGTGG + Intronic
902208106 1:14884684-14884706 CTGATTCAGTAGCTCTGACGTGG + Intronic
902338239 1:15766065-15766087 CTGATTCAGCAGATCTGCCGTGG + Intronic
903743464 1:25571778-25571800 CTGATCCAGTACCTCTGTGCTGG - Intergenic
905537142 1:38731150-38731172 CTGATTCAGCAGGTCTGGGTGGG - Intergenic
907187454 1:52620860-52620882 CTGATTCAGCTAGTCTGACTGGG - Intergenic
907659561 1:56379294-56379316 CTGATTCAGAAACTCTGACATGG + Intergenic
908145142 1:61233757-61233779 TTGATTGAGCACCTCTGCGTCGG - Intronic
909034923 1:70586170-70586192 CTGATTCAGTTCCTCTGTGGGGG - Intergenic
910393985 1:86773557-86773579 TTGATTCAGCTCCTCTGATTAGG - Intergenic
911036340 1:93553160-93553182 CATCTTCAGCACCTCAGTCTGGG + Exonic
913063993 1:115232836-115232858 CAGATTCATGACCTCTTTCTTGG + Intergenic
915064353 1:153212390-153212412 CTGATTCAGACCCCCTGTGTGGG + Intergenic
916172014 1:162008696-162008718 CTGATTCAGCAGGTCTGAGTGGG - Intronic
916923734 1:169495923-169495945 CTGATTCAGGACCCCCGTCCAGG + Intergenic
917952835 1:180058095-180058117 ATGACTCAGCAGTTCTGTCTTGG + Intronic
918824694 1:189309409-189309431 CTGATTTAACAGCTCTGTGTAGG - Intergenic
918905471 1:190486943-190486965 CTTATTCAGCACTTTTTTCTAGG - Intergenic
1063572359 10:7227984-7228006 CTGATTTTGCTCATCTGTCTGGG - Intronic
1064014321 10:11760990-11761012 CTAAATCACCACCTCTGTTTTGG - Intronic
1064113716 10:12559957-12559979 GTGAGTTAGCACCTCTGTCATGG + Intronic
1064147928 10:12840136-12840158 TTGATTCAGCAGCTCTGGCCTGG + Intergenic
1064174572 10:13063238-13063260 TTGATTTATCAGCTCTGTCTAGG + Intronic
1067841264 10:49681183-49681205 CTGATTCAGCACCTCTGTCTAGG - Intronic
1068090755 10:52429813-52429835 CTGATTCAGCAGGTCTGGCATGG + Intergenic
1068297932 10:55099049-55099071 CTGAATCAGCATCACTGTCTGGG - Intronic
1069870343 10:71529139-71529161 CTGATTCAGTAGCTCTGGGTGGG + Intronic
1070358251 10:75661420-75661442 CTGATTCAGGAGGTCTGGCTGGG + Intronic
1070420925 10:76236464-76236486 CTGATTCAGTTCCTCTGTTGGGG - Intronic
1070488654 10:76954962-76954984 GTGATTCAGCACCTCGGGTTTGG + Intronic
1070542625 10:77427483-77427505 CTGATTCAGTATCTGTATCTGGG - Intronic
1070553588 10:77511167-77511189 CTGATTCAGCAGCTCTGGGCTGG + Intronic
1070704028 10:78624646-78624668 CTGATGCTGCAGCTCTCTCTTGG - Intergenic
1071853555 10:89600213-89600235 CTGTGTAAGCACCTCTTTCTTGG - Intronic
1073480285 10:103782264-103782286 CTGATTCAGCAGGTCCGCCTGGG - Intronic
1074887102 10:117702436-117702458 CTGATTCAGCTACCCTCTCTTGG + Intergenic
1074993612 10:118735455-118735477 CTGATTCAGCAGGTCTGTGTTGG - Intronic
1075553155 10:123408907-123408929 CTGATTCAGCAGGCCTGGCTTGG + Intergenic
1079468911 11:20759703-20759725 CTAAATCACCACCTCTGTCCAGG + Intronic
1080744779 11:35098994-35099016 CAGAGCAAGCACCTCTGTCTGGG - Intergenic
1081741225 11:45442225-45442247 CTGATCCAGTGCCTCTGTGTAGG + Intergenic
1082778928 11:57271085-57271107 CAGCTTCACCACCTCTTTCTTGG - Intergenic
1083610392 11:64001478-64001500 CTCCTTCATCACCTCAGTCTCGG + Intronic
1084031842 11:66485716-66485738 CTGATTCAGCAGGTCTGTGGTGG + Intronic
1084559783 11:69897228-69897250 CAGATGCAGCCCCTCAGTCTTGG - Intergenic
1084738215 11:71119741-71119763 CTGATTCAGCAGGTCTGGGTGGG + Intronic
1085659872 11:78353972-78353994 GTGATTCAGTAGCTCTGGCTTGG + Intronic
1086190107 11:84069105-84069127 CTGAATCAGCACCTCTGGAGGGG - Intronic
1087073648 11:94107028-94107050 CTGATTCAGCAGGTCTGGGTCGG - Intronic
1090244245 11:125204346-125204368 CTGATTCAGCAGGTCTGTGTGGG + Intronic
1090298013 11:125607578-125607600 CTGATTCAGTAGGTCTGTGTTGG - Intronic
1090669092 11:128933674-128933696 GAGATTCAGCACATGTGTCTTGG + Intergenic
1090931117 11:131299017-131299039 CTGATTCAGGACGTCTGTAATGG + Intergenic
1091147578 11:133293081-133293103 ATAATCCAGCACCTCAGTCTGGG + Intronic
1091377654 12:36205-36227 CTGATGCAGCACCTGTGAATGGG - Intergenic
1091846039 12:3657012-3657034 CTGCTTCAGCACCTCTCTGTGGG - Intronic
1094476902 12:30847453-30847475 CTAATTCAGCACTTGTGCCTGGG - Intergenic
1099337050 12:81375776-81375798 CAGGTTCAGTATCTCTGTCTTGG - Exonic
1102192352 12:110998295-110998317 CTGTTGCAACTCCTCTGTCTTGG + Intergenic
1102409318 12:112703655-112703677 CTGATTCAGCTCCTCTGTGGAGG - Intronic
1103024192 12:117560173-117560195 CTGATTCAGCAGATCTGCCAGGG - Intronic
1104496180 12:129241577-129241599 CTGATTAAGCACCACTTCCTTGG + Intronic
1105643813 13:22294985-22295007 CAGATTCAGCCCCTCGATCTTGG + Intergenic
1106901436 13:34358108-34358130 CTGATTCAGCAGGTCTGGGTGGG - Intergenic
1107477984 13:40759007-40759029 CTGGCTCAGCAGCTCTGACTTGG + Exonic
1107478912 13:40768741-40768763 CTGATTCAACAGCTTTGTCCAGG + Intronic
1108167197 13:47706134-47706156 GTGTTTCAGCACCTCTCACTAGG - Intergenic
1111020895 13:82449643-82449665 ATGATTCAGCAATCCTGTCTTGG + Intergenic
1111159125 13:84370248-84370270 ATTTTTCAGCACATCTGTCTTGG - Intergenic
1112990403 13:105506551-105506573 CTGATTCAGCAGGTCTGGGTGGG + Intergenic
1113125891 13:106979145-106979167 CTGATTCAGTAGGTCTGGCTGGG + Intergenic
1114510228 14:23252720-23252742 CTGATTCAGTTCCTCTGTGGGGG + Intronic
1115153054 14:30307543-30307565 CTGATTCAGCAGATCTGAATGGG - Intergenic
1119093357 14:71805440-71805462 CAGATGCAGCCCCTCAGTCTTGG + Intergenic
1119138553 14:72243797-72243819 CTGATTCAGCTATTCAGTCTGGG + Intronic
1119214358 14:72857049-72857071 CTGATTCAGCAGCTCTTCCAGGG - Intronic
1119545589 14:75469330-75469352 CTGCTTCAGCTCCTCAATCTGGG - Exonic
1119843514 14:77810996-77811018 CTGATTAGGGACCTGTGTCTCGG + Intronic
1119933373 14:78568921-78568943 CTGATTCAGCAGGTCTGTGGTGG + Intronic
1121837779 14:97107284-97107306 CTGATTCAGCAGCTCTGGGTGGG + Intergenic
1122806979 14:104264753-104264775 CTGCGTCAGCACCACTGCCTGGG - Intergenic
1126751760 15:51884983-51885005 CTGATGCAGCAGGTCTGACTGGG - Intronic
1126790120 15:52213187-52213209 CTCATTCAGAACCTCATTCTTGG - Exonic
1127107149 15:55628544-55628566 CTGATGTGGCTCCTCTGTCTTGG + Intronic
1127361826 15:58251206-58251228 CTGAATCAGCATCTCTGGATTGG - Intronic
1129194358 15:73955335-73955357 CTGACCCAGCACCTCCTTCTGGG + Intergenic
1129544261 15:76377870-76377892 CTGACTCAGCATGTCTGTTTAGG + Intronic
1130612629 15:85375350-85375372 CTGATACAGAGCCTCTATCTAGG - Intergenic
1131003977 15:88960815-88960837 CTGGTGCTGCCCCTCTGTCTGGG - Intergenic
1132449274 15:101956787-101956809 CTGATGCAGCACCTGTGAATGGG + Intergenic
1132591758 16:729165-729187 CTGAGTGAGCATCTCTGGCTTGG + Intronic
1133886585 16:9834207-9834229 ACCATTCAGCGCCTCTGTCTGGG - Exonic
1135635927 16:24075532-24075554 CTGATTCAGTTCCTCTGTTTGGG + Intronic
1135862240 16:26067274-26067296 CTGATTCAGAACTTCTCTCTAGG - Intronic
1136399560 16:30010218-30010240 CTCATGCAGCACCCCTGGCTAGG + Exonic
1137797868 16:51237445-51237467 CTCATTCAGCACCACTGTCCAGG - Intergenic
1138958013 16:61994696-61994718 CTGATTCAGTACCTCTGTGGTGG - Intronic
1141985911 16:87579838-87579860 CAGATTCAGCAGCTCTTCCTGGG + Intergenic
1142264046 16:89055446-89055468 CTGACTCAGCCCATCTGTCGGGG - Intergenic
1142781743 17:2186623-2186645 TTGCTTCAGCACCACTGGCTTGG - Intronic
1143047455 17:4093621-4093643 CTGATTCAGGAGCTCTGGGTGGG - Intronic
1143870146 17:9952170-9952192 CTGATTCAGGAGCTCTGGATGGG + Intronic
1144013225 17:11170129-11170151 CTTATTCAGCACCTACATCTGGG + Intergenic
1144637628 17:16920364-16920386 CTGATTCAGCAGGTCTGTGGGGG + Intergenic
1145211243 17:21014937-21014959 CTGATTCAGCAGATCTGTGGGGG - Intronic
1146705148 17:34995863-34995885 CTGTTTCAGTACTTCTGTCCGGG - Intronic
1150132941 17:62679105-62679127 CTGAGACACCACCTCTGTCCTGG + Intronic
1150809244 17:68343744-68343766 CTGCTGCAGCACCTCTGCCAAGG - Exonic
1150875140 17:68962752-68962774 CGAAGTCAGCACCTCTGTCATGG + Intergenic
1150939014 17:69669875-69669897 CTGAATCAGGACCTCAGGCTGGG + Intergenic
1156620618 18:38847032-38847054 CTGTCTCTGCATCTCTGTCTTGG + Intergenic
1157847177 18:51014747-51014769 CTGAAGCAGCATCACTGTCTGGG - Intronic
1158396921 18:57086492-57086514 CTGATTCAGTCCCTCTGTTGGGG + Intergenic
1158496387 18:57958817-57958839 CAGGTTAAGAACCTCTGTCTGGG - Intergenic
1159872005 18:73768863-73768885 CTAATTCATCACCACTGTCCTGG - Intergenic
1160486050 18:79293586-79293608 CAGATGCAGCACCTCAGCCTCGG + Intronic
1160635982 19:75766-75788 CTGATGCAGCACCTGTGAATGGG - Intergenic
1161809212 19:6462021-6462043 CTGTTCCAGCACACCTGTCTAGG - Intronic
1162502951 19:11064936-11064958 CTGAGTCAGCACCTCTGCCCGGG + Intronic
1162947729 19:14053956-14053978 CTCATTCATCTCCTCTGCCTGGG + Exonic
1163065931 19:14795309-14795331 TTGATAAAGCAGCTCTGTCTAGG - Intronic
1163419522 19:17206287-17206309 CTGCTTCAGCACCCCTGTGATGG - Exonic
1163631826 19:18421468-18421490 CTGATTCAGCATATCTGCCCTGG + Intronic
1165074326 19:33272531-33272553 CCGCTTCCGCACCTTTGTCTAGG - Intergenic
1165137353 19:33677990-33678012 CTGATTCAGCACCTGTAGCCTGG - Intronic
1165581364 19:36867639-36867661 ATGATTTAGCACTTCTGTTTAGG + Intronic
1166713086 19:44949439-44949461 CTGAGTCAGCCCCTCCATCTTGG - Exonic
1167114519 19:47480816-47480838 CTGATGCAGCCCCTCGTTCTGGG + Exonic
1167416131 19:49373839-49373861 CTGATTCAGCAGGTCTGAGTGGG + Intronic
1167757146 19:51419854-51419876 TTGTTTCAGCCCCTCTGTCTGGG - Intergenic
927750461 2:25664933-25664955 CTGATCCAGCACCACAGTTTTGG - Intronic
929198377 2:39209560-39209582 CTGATTCAGCAGGTCTGTAGTGG + Intronic
929699471 2:44149491-44149513 CAGATGCAGCCCCTCAGTCTTGG + Intergenic
930171325 2:48254729-48254751 CAGATGCAGCTCCTCAGTCTTGG - Intergenic
932119927 2:69088999-69089021 CTGAGGCTGCACCTGTGTCTGGG + Intronic
932357152 2:71076375-71076397 CTGAGTGAGCACCTCTGTACAGG + Intronic
934031454 2:88051818-88051840 CTGATTTAACACATCTGTGTTGG - Intronic
935469336 2:103438139-103438161 TTGATTCATCACCTCTTTCTTGG - Intergenic
935496134 2:103783658-103783680 CTGATTCAGCAGCTCTGCGATGG - Intergenic
936565498 2:113579286-113579308 CTGATGCAGCACCTGTGAATGGG + Intergenic
938109121 2:128552479-128552501 CTGAATCAGCACCTCTATACTGG + Intergenic
939465021 2:142545726-142545748 CTGATTGTGTAACTCTGTCTGGG - Intergenic
940305999 2:152227560-152227582 CTGATTCAGTAGCTCTGGCGTGG - Intergenic
941039239 2:160601736-160601758 CTGATTCTTCACCTCAGTGTTGG + Intergenic
942063126 2:172246646-172246668 GTGATTCAGCACCAGTGTGTTGG + Intergenic
942237148 2:173921824-173921846 ATGGTTTAGCACCACTGTCTTGG + Intronic
942395104 2:175538857-175538879 CTGCTGTAGCACATCTGTCTTGG + Intergenic
942806368 2:179935954-179935976 CAGATTCTGCTCCTCTCTCTGGG + Intergenic
942865023 2:180663056-180663078 CTGATTCAGTACCTAGCTCTGGG + Intergenic
943203064 2:184855083-184855105 CTGATTAAACATCACTGTCTTGG + Intronic
944916116 2:204362266-204362288 CTGGTTGAGCCTCTCTGTCTTGG + Intergenic
945742884 2:213685082-213685104 TTTATTCAGCCCTTCTGTCTGGG - Intronic
947922173 2:233886747-233886769 TTGATTGAACAACTCTGTCTTGG + Intergenic
948083309 2:235225520-235225542 CTGATTCAGCCCAGCTGTGTCGG + Intergenic
949020458 2:241738316-241738338 CTGGCTCAGCACTGCTGTCTGGG + Intronic
1169301342 20:4444241-4444263 CTGTTTCAGCCCATCTCTCTGGG - Intergenic
1169413264 20:5392851-5392873 CTGATTCAGCATATCTGGATGGG + Intergenic
1169723108 20:8700499-8700521 CTGATTGAACATCTCTTTCTGGG + Intronic
1169745316 20:8936946-8936968 CTGCTCCACCACCACTGTCTGGG + Intronic
1169749002 20:8972845-8972867 CTGATTCAGCACTTCTGGGAAGG - Intergenic
1170644450 20:18184810-18184832 ATGATTTATCACCTGTGTCTGGG + Intronic
1172042293 20:32053828-32053850 CTGATTCAGTAGCTCTGTGCAGG + Intronic
1172699605 20:36845166-36845188 CTGATTCAGCAAGTCTGGGTTGG - Intronic
1173013149 20:39200670-39200692 CTGTTTCACCACCTCTCACTGGG - Intergenic
1173632799 20:44529334-44529356 TTGATTAATCAGCTCTGTCTAGG - Intergenic
1173765222 20:45601100-45601122 CAGGTTCAGAACCTCTCTCTAGG + Intergenic
1173915439 20:46704827-46704849 CTGATTCAGTTCCTCTGTGGGGG + Intergenic
1175318054 20:58065638-58065660 CTGATTCAGCAGGTCTGGGTGGG - Intergenic
1175597847 20:60249676-60249698 CTGATTCAGGACCTCTGGGGTGG - Intergenic
1175744263 20:61443055-61443077 CTGATTGAGAACCGCTGCCTAGG + Intronic
1175952066 20:62588843-62588865 GTGATCCCGGACCTCTGTCTAGG + Intergenic
1178990699 21:37353212-37353234 CTGAGTTTACACCTCTGTCTTGG - Intergenic
1179305876 21:40153684-40153706 CTGATTCAGGAACTCTGAGTGGG - Intronic
1180879270 22:19192462-19192484 CACATTCATCACCACTGTCTTGG - Intronic
1181359632 22:22324436-22324458 CAGATTCAGCACCAGTGTCTGGG + Intergenic
1181369704 22:22406174-22406196 GAGATTCAGCACCAGTGTCTGGG + Intergenic
1183074603 22:35419064-35419086 CTGATTCAGCACCTCTGCCAGGG + Intronic
949511231 3:4768831-4768853 ATGGTTCAGCACCTCTCACTTGG + Intronic
950100736 3:10355141-10355163 TTGATTCAGCACCTCCGAGTGGG - Intronic
950378794 3:12593731-12593753 CTGTTCCAGCACTCCTGTCTTGG - Intronic
951082519 3:18468580-18468602 CTGATTCAGCACATCTGAGGTGG + Intergenic
951620010 3:24591388-24591410 CTGATTCAGCAGATCTGGGTTGG - Intergenic
951926380 3:27913143-27913165 CTGATTCAGCAGGTCTGGCATGG + Intergenic
952311437 3:32194019-32194041 CTGATTCAGCAGGTCTGCATGGG + Intergenic
953707129 3:45239781-45239803 CTGATTCAGCACATCTGGGTGGG + Intergenic
953807720 3:46085855-46085877 CTGATTCAGCATGTCTGGGTTGG - Intergenic
953831167 3:46298623-46298645 CTGATTCAGCAGGTCTGGGTTGG - Intergenic
955595753 3:60588580-60588602 CTGATTCAGAACCTCTGGGGTGG + Intronic
955981518 3:64532046-64532068 CCGATTCAGCTCATCTGTGTGGG + Intronic
955993502 3:64653981-64654003 CTGATTTAACACCTTTGTCTAGG - Intronic
956291184 3:67662000-67662022 CTGATTCAGTAGGTCTGTCTTGG + Intergenic
956351405 3:68341081-68341103 TTGATACATCAGCTCTGTCTAGG - Intronic
956891669 3:73620151-73620173 CTGATTCAGAAACTCTGGTTTGG + Intronic
956899891 3:73704405-73704427 CTGATTCCGCAGCTCTGTGTGGG + Intergenic
958434714 3:94082335-94082357 CTGAATCAGAAACTCTGGCTAGG + Intronic
958587599 3:96110309-96110331 GTGATTCAGCACCTCAGTAATGG + Intergenic
960300605 3:115998604-115998626 CGGATTCAGCATCTCTGGGTGGG - Intronic
960669890 3:120145740-120145762 CTGATTCAGCAGATCTGGGTGGG + Intergenic
960731333 3:120731034-120731056 CTGATTTAGCGGGTCTGTCTTGG + Intronic
960817936 3:121692524-121692546 CTGAAGCTGGACCTCTGTCTGGG + Exonic
961058338 3:123807859-123807881 CTGATGCAGCACCTAAGGCTGGG - Intronic
962093105 3:132266002-132266024 CAGATTCAGTAGCTCTGACTTGG + Intronic
962942681 3:140140166-140140188 CCGTTTGAGAACCTCTGTCTAGG + Intronic
966457740 3:180136748-180136770 CTGATTCAGTTCCTCTGTGGAGG + Intergenic
966555597 3:181257126-181257148 CAGATGCAGCCCCTCAGTCTTGG - Intergenic
967854058 3:194103311-194103333 CTGATTCAGCAGCTCTGGTATGG + Intergenic
970450056 4:16157411-16157433 CTGATTCAGCACATCTGGGCAGG + Intergenic
970958917 4:21850042-21850064 CTGTTTCAGTTACTCTGTCTTGG - Intronic
971865584 4:32166452-32166474 CTCATTCAGCATCTATTTCTTGG + Intergenic
972179462 4:36445826-36445848 CTGAGTCAGCATCATTGTCTGGG + Intergenic
975919412 4:79366453-79366475 CTGATTCTGCACCTTTATCCTGG + Intergenic
976517944 4:85993180-85993202 CTGATTCAGAAGCTCTGCATTGG + Intronic
977091617 4:92683394-92683416 CAGATTGTGCACTTCTGTCTAGG - Intronic
977615670 4:99085526-99085548 CTGATTCAGCAGGTCTGGCATGG + Intronic
978275806 4:106948294-106948316 CTGATTCAGTAGGTCTGTGTGGG + Intronic
978849702 4:113318937-113318959 ATGATTCAGCCCCTCTTTTTAGG - Intronic
978970456 4:114797778-114797800 CTCATTCAACAACTCTTTCTGGG + Intergenic
979341510 4:119529962-119529984 CTGATTCAGTAGGTCTGTGTTGG - Intronic
979726983 4:123974009-123974031 CTGATTCAGCAAGTCTGAGTGGG + Intergenic
980339982 4:131532304-131532326 CTGATAAATCAGCTCTGTCTAGG + Intergenic
980432544 4:132722894-132722916 ATGATTCAGGACATTTGTCTTGG - Intergenic
983275657 4:165614331-165614353 CAGATTCTGAATCTCTGTCTTGG - Intergenic
983567932 4:169174433-169174455 CTGATTCAGTACCTCTGGGTGGG + Intronic
985622603 5:963312-963334 CCGAGGCAGCACCTCTGGCTTGG + Intergenic
985653514 5:1118280-1118302 TTGATCCATCAGCTCTGTCTGGG + Intergenic
988770022 5:34423222-34423244 CTGATGCAACACCTGTATCTGGG + Intergenic
989078005 5:37585659-37585681 TTGATCCAGTACCTTTGTCTGGG + Intronic
989099482 5:37810858-37810880 CTGATTTTCCACCTCTATCTCGG + Intergenic
993076340 5:83236631-83236653 GTGATTCAGGACATTTGTCTGGG + Intronic
993132224 5:83913094-83913116 CTGATTCAGCATTTCTGGATTGG + Intergenic
993501221 5:88669519-88669541 ATGATTCTGCATCTGTGTCTTGG - Intergenic
994993885 5:107034851-107034873 CTGATTCAGTACCTCTGGGTGGG - Intergenic
995835819 5:116398462-116398484 CTGGTTTAGCACCTCTCTCATGG + Intronic
995988155 5:118205751-118205773 ATGATTCAGCAGCTCTTTCCAGG + Intergenic
996469734 5:123845544-123845566 CTGATTCAACACCTCTGCGGTGG - Intergenic
997732943 5:136193818-136193840 CTGATTGCACACCTCTGTCCTGG - Intergenic
998628379 5:143871447-143871469 CTGATTCAGAACCTCTGACAAGG + Intergenic
998975483 5:147641614-147641636 CTGATTCATCACATCTTTGTAGG + Intronic
999119884 5:149201013-149201035 GAGATTCAGAACCACTGTCTAGG + Intronic
1003492055 6:6631602-6631624 CTGATTCAGTACGTCTGGGTAGG - Intronic
1004195748 6:13503087-13503109 CTGAAACATCACCTCTTTCTGGG + Intergenic
1004204940 6:13583731-13583753 CTGATTCAGCAGCTCTGAGGTGG + Intronic
1006451059 6:34105952-34105974 CAGCTCCAGCATCTCTGTCTGGG + Intronic
1007286362 6:40750687-40750709 CTGATTCAGCGATTCTGTGTGGG - Intergenic
1007433825 6:41793608-41793630 TTGATCCAGCCCCTCAGTCTCGG - Exonic
1009184608 6:60559627-60559649 CAGATGCAGCCCCTCAGTCTTGG + Intergenic
1009833634 6:68970395-68970417 CTGCTTCAGCACCTGTAGCTGGG + Intronic
1010015994 6:71105371-71105393 CTCATCCAGCACCACTATCTGGG - Intergenic
1011952892 6:92989692-92989714 CTGATTCAGCAGGTCTGGATGGG - Intergenic
1012480802 6:99664776-99664798 CTGATTCAGTTCCTCTGTGGGGG + Intergenic
1013208680 6:107967575-107967597 CTGAATCAGAAACTCTGGCTTGG - Intergenic
1014536141 6:122615315-122615337 CTCATTCAGCATCTCTTGCTTGG - Intronic
1016923777 6:149319607-149319629 GTGATTCAGAACTTCTGTTTGGG + Intronic
1018309234 6:162491417-162491439 CTGGTGCGTCACCTCTGTCTGGG - Intronic
1018390537 6:163337758-163337780 GTGATTCATCCCCCCTGTCTAGG - Intergenic
1019069843 6:169335293-169335315 CTTTTTCTGCACTTCTGTCTAGG - Intergenic
1021191356 7:17623489-17623511 CTGTTTCAGGCCCTCAGTCTTGG - Intergenic
1022537191 7:31105523-31105545 CTGCCCCAGCACCTCTGTTTTGG - Intronic
1022711308 7:32853631-32853653 CTGACTCAGGACCTTTGGCTTGG + Intergenic
1022913354 7:34921331-34921353 CTGACTCAGGACCTTTGGCTTGG - Intergenic
1023827562 7:44019653-44019675 CTGCTGCAGGACCTCTGCCTGGG + Intergenic
1023831416 7:44040723-44040745 CTGCTCCAGCACCTCGGCCTCGG + Intergenic
1024569155 7:50709832-50709854 CTGACTTAGCAGCTCTGGCTGGG - Intronic
1024890816 7:54200735-54200757 CTGACTCAACACATCTGTATTGG - Intergenic
1027573086 7:79896335-79896357 CTTATTCAGCACCTCTAGCTGGG - Intergenic
1028094979 7:86748914-86748936 CTTACTCTGGACCTCTGTCTTGG - Intronic
1028146662 7:87327362-87327384 CTGATAAATCAGCTCTGTCTAGG + Intergenic
1029738736 7:102479422-102479444 CTGCTGCAGGACCTCTGCCTGGG + Intergenic
1029741741 7:102495025-102495047 CTGCTCCAGCACCTCGGCCTCGG + Exonic
1029755862 7:102573079-102573101 CTGCTGCAGGACCTCTGCCTGGG + Intronic
1029759732 7:102594194-102594216 CTGCTCCAGCACCTCGGCCTCGG + Exonic
1029773804 7:102672152-102672174 CTGCTGCAGGACCTCTGCCTGGG + Intergenic
1029777095 7:102690104-102690126 CTGCTCCAGCACCTCGGCCTCGG + Intergenic
1029952493 7:104601910-104601932 GTGATTCAGGGGCTCTGTCTGGG - Intronic
1030042866 7:105467725-105467747 CTGAGTAAGCACCTCTCTCTGGG - Intronic
1030803972 7:113890387-113890409 CTGAATCAGCATCTCTGAGTGGG + Intronic
1033714723 7:143988282-143988304 CTGATTAAGCACTTCCCTCTAGG + Intergenic
1035413430 7:158664682-158664704 CTGATTCTCGACCTGTGTCTCGG - Exonic
1035472370 7:159118641-159118663 CTGATCATGCATCTCTGTCTGGG - Intronic
1035916804 8:3634046-3634068 CTGACTCAGCACATCTGGGTAGG + Intronic
1037821945 8:22139336-22139358 CTCATTCAGCTCCTCTGCCAGGG - Intronic
1038081692 8:24144624-24144646 CTGATTCTTCCTCTCTGTCTAGG - Intergenic
1038353065 8:26798548-26798570 CTGAATTATCATCTCTGTCTGGG - Intronic
1039122890 8:34168725-34168747 CTGTTTCAGCACCTTTCTGTTGG - Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1040823259 8:51589147-51589169 CAGATGCAGCCCCTCAGTCTTGG + Intronic
1041583304 8:59487263-59487285 TTAATTCAGAAACTCTGTCTAGG + Intergenic
1043220880 8:77662109-77662131 TTGATAAATCACCTCTGTCTGGG + Intergenic
1044734032 8:95259329-95259351 CTCACTCAGTACCTCTTTCTGGG - Intronic
1045883214 8:107065162-107065184 CTGGTTCAGCACCCCTTTCCAGG + Intergenic
1045894198 8:107194619-107194641 CTGATTCAGCAGGTCTGAGTGGG - Intergenic
1047450600 8:124962034-124962056 CTGACTCAGCACCTCTGGGGTGG - Intergenic
1047554138 8:125910370-125910392 CTGTTATAGAACCTCTGTCTGGG + Intergenic
1047554918 8:125918934-125918956 CTGTTTTAGAACCTCTGTCTGGG + Intergenic
1047991690 8:130293198-130293220 CTGATTCAGCAGGTCTGACGAGG + Intronic
1049886927 9:33940-33962 CTGATGCAGCACCTGTGAATGGG - Intergenic
1051712155 9:19942416-19942438 CTGATTCAGGACTTATGTCCAGG + Intergenic
1051742919 9:20268606-20268628 CAGATGCAGCCCCTCAGTCTTGG + Intergenic
1052083882 9:24239966-24239988 CTGATTCAGCAAGTCTGGGTGGG + Intergenic
1053115906 9:35502114-35502136 CTGATTCAGTACATCTGGCATGG + Intronic
1053549363 9:39059554-39059576 CTGATTCATTATCTCTTTCTGGG + Intergenic
1053675503 9:40421479-40421501 ATGATTCAGTACCTCTCACTGGG - Intergenic
1053813480 9:41879614-41879636 CTGATTCATTATCTCTTTCTGGG + Intergenic
1054288777 9:63260005-63260027 ATGATTCAGTACCTCTCACTGGG - Intergenic
1054386602 9:64561542-64561564 ATGATTCAGTACCTCTCACTGGG - Intergenic
1054509118 9:65954813-65954835 ATGATTCAGTACCTCTCACTGGG + Intergenic
1054617116 9:67307825-67307847 CTGATTCATTATCTCTTTCTGGG - Intergenic
1054775895 9:69123039-69123061 CTGATTCAGCAGATCTGGGTGGG - Intronic
1054916499 9:70499444-70499466 CGGATTCAGCACATCTGCCATGG - Intergenic
1055991859 9:82114820-82114842 CTGATTCAGAAGGTCTGGCTTGG + Intergenic
1058144310 9:101394632-101394654 TTGATACATCAGCTCTGTCTAGG + Intronic
1058991667 9:110259486-110259508 CTGATTCTGTATGTCTGTCTGGG - Intergenic
1059210585 9:112511258-112511280 CTGATTCAGTATGTCTGTCTGGG - Intronic
1059246185 9:112851607-112851629 CTGATAAATCAGCTCTGTCTAGG - Intronic
1059554042 9:115260684-115260706 CAGATGCAGCCCCTCAGTCTTGG - Intronic
1060292307 9:122315133-122315155 CTGATACAGTAGCTCTGCCTAGG + Intronic
1061206993 9:129170347-129170369 CTGAGCCAGAACCTGTGTCTGGG + Intergenic
1062601433 9:137320235-137320257 CTGTGCCAGCCCCTCTGTCTGGG - Intronic
1062678686 9:137763998-137764020 CTGATTCAGCAGGTCTGGCCTGG + Intronic
1185770473 X:2762021-2762043 ATGCTTCAGCAGGTCTGTCTGGG - Intronic
1186904841 X:14100124-14100146 CTGATTCAGTACATCTGGGTGGG - Intergenic
1187027669 X:15452777-15452799 CTGATTCAGCACATCTGAGATGG - Intronic
1187292381 X:17967487-17967509 CTGATTCAGCAGCTCTGGAGTGG + Intergenic
1191998654 X:67124352-67124374 CTGATTCAGCATGTCTGTAATGG - Intergenic
1192118335 X:68432527-68432549 CATATTCAGCACCCCTGTCTGGG - Intronic
1192754113 X:74028213-74028235 ATGATTGAGCACTTCTGTTTTGG - Intergenic
1195430864 X:104787793-104787815 CTGATTCAGGAGCTCTGAATAGG + Intronic
1195453212 X:105038728-105038750 CTGCTGCAGAACCTCTTTCTAGG + Intronic
1195656652 X:107337665-107337687 CAGTCTCAGCAGCTCTGTCTGGG + Intergenic
1196070458 X:111515602-111515624 CTGATTCAGTAGCTCTGTATGGG - Intergenic
1196292537 X:113960269-113960291 CTTATTAAGGACCTTTGTCTTGG + Intergenic
1197120778 X:122889482-122889504 CAAATTCAACACCTCTGTCCAGG - Intergenic
1198111331 X:133505010-133505032 CTGAGTGACCACCTCTGTCCAGG + Intergenic
1198141097 X:133804326-133804348 CTGATTCAGCACATCTGGAATGG - Intronic
1201142965 Y:11043655-11043677 CTGATTCAGCAGGTCTGGGTGGG + Intergenic
1201299790 Y:12495711-12495733 ATGCTTCAGCAGGTCTGTCTGGG + Intergenic