ID: 1067841340

View in Genome Browser
Species Human (GRCh38)
Location 10:49681861-49681883
Sequence CTGTAGTCACATTGGGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067841335_1067841340 -1 Left 1067841335 10:49681839-49681861 CCTTAATTACCTCTTTAAGCACC 0: 1
1: 0
2: 56
3: 254
4: 751
Right 1067841340 10:49681861-49681883 CTGTAGTCACATTGGGAGTTAGG No data
1067841336_1067841340 -10 Left 1067841336 10:49681848-49681870 CCTCTTTAAGCACCTGTAGTCAC 0: 1
1: 0
2: 1
3: 10
4: 110
Right 1067841340 10:49681861-49681883 CTGTAGTCACATTGGGAGTTAGG No data
1067841332_1067841340 23 Left 1067841332 10:49681815-49681837 CCTCATCCTTATAACCTCATTTA 0: 2
1: 39
2: 186
3: 512
4: 1017
Right 1067841340 10:49681861-49681883 CTGTAGTCACATTGGGAGTTAGG No data
1067841333_1067841340 17 Left 1067841333 10:49681821-49681843 CCTTATAACCTCATTTAACCTTA 0: 14
1: 171
2: 538
3: 950
4: 1479
Right 1067841340 10:49681861-49681883 CTGTAGTCACATTGGGAGTTAGG No data
1067841334_1067841340 9 Left 1067841334 10:49681829-49681851 CCTCATTTAACCTTAATTACCTC 0: 126
1: 539
2: 1043
3: 1705
4: 2402
Right 1067841340 10:49681861-49681883 CTGTAGTCACATTGGGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067841340 Original CRISPR CTGTAGTCACATTGGGAGTT AGG Intronic
No off target data available for this crispr