ID: 1067842025

View in Genome Browser
Species Human (GRCh38)
Location 10:49688640-49688662
Sequence GAGGATAGGCAGAAGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1146
Summary {0: 1, 1: 0, 2: 10, 3: 125, 4: 1010}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067842025 Original CRISPR GAGGATAGGCAGAAGCAGGA GGG (reversed) Intronic
900018480 1:170734-170756 GAGGAGAGGCAGGGGCAGGAGGG + Intergenic
900048738 1:529329-529351 GAGGAGAGGCAGGGGCAGGAGGG + Intergenic
900070969 1:771153-771175 GAGGAGAGGCAGGGGCAGGAGGG + Intergenic
900093819 1:932304-932326 GAGGCCAGGCAGACGGAGGAGGG - Intronic
900190995 1:1352154-1352176 GAGGAGTGGCGGGAGCAGGAAGG - Intergenic
900391590 1:2436214-2436236 GAGGAAAGGAGGAGGCAGGAAGG - Intronic
900491434 1:2951217-2951239 GAGAATAGGCAGGGGCAGGCAGG - Intergenic
900624140 1:3600487-3600509 GAGGACAGGCGGGAGCTGGAGGG + Intronic
900759558 1:4461847-4461869 GTGGCCAGGCAGAAGCAGGGAGG - Intergenic
901166441 1:7225000-7225022 GAGGCTAGGAAGAGTCAGGAAGG + Intronic
901443978 1:9295704-9295726 GAGGAGGGGCAGGTGCAGGAAGG - Intronic
901472527 1:9467636-9467658 GAGGAAAGGAAAAAGCAAGAAGG + Intergenic
901530868 1:9851773-9851795 CAGGACAGGCAGTGGCAGGAGGG + Intronic
901535162 1:9877960-9877982 GTGGCTGGGCAGAAGTAGGAAGG + Exonic
901622754 1:10601860-10601882 GAGGATAGGCAGCGGCAGCTGGG + Intronic
901631062 1:10648364-10648386 GAGGAAGGGCACAAGTAGGAAGG - Intronic
901675085 1:10878625-10878647 GGGGACAGTCAGAGGCAGGAGGG + Intergenic
901773416 1:11542917-11542939 GAGAAGAGGCAGGAGGAGGATGG - Intergenic
902397484 1:16140249-16140271 GAGGGTCTGCAGAAGCAGGATGG - Intronic
902689467 1:18101228-18101250 GAGGGGAGGGAGAAGAAGGAGGG - Intergenic
902959950 1:19956232-19956254 GAGGAAAGGGAGTTGCAGGAGGG - Intergenic
903799465 1:25955736-25955758 GAGGGAAGGAAGAAGGAGGAAGG + Intergenic
904409170 1:30314573-30314595 GAGGGAAGGGAGAAGCAGGGAGG + Intergenic
904832549 1:33314423-33314445 CAGGAGAGGCAGGGGCAGGAGGG - Intronic
904962764 1:34347768-34347790 GAGACAAGGCAGAGGCAGGATGG + Intergenic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905257366 1:36693465-36693487 GAGGAGAGACAAAAGGAGGAAGG + Intergenic
905275403 1:36814367-36814389 GGGGATAGGCAGGAGCAGGCAGG + Intronic
905505198 1:38473768-38473790 GAGGATAGGGAGAAATGGGAAGG + Intergenic
906268724 1:44456981-44457003 GGGGATAGGTAGGAGCAGGAGGG - Intronic
906391847 1:45424293-45424315 GAGGCCAGGCAGAAGAGGGAAGG + Intronic
906579634 1:46925692-46925714 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
906604089 1:47153196-47153218 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
906860814 1:49357193-49357215 GAGGACACAGAGAAGCAGGAGGG - Intronic
907050404 1:51326241-51326263 GAGGCTGGGCGGAAGGAGGATGG + Intronic
907222084 1:52914506-52914528 CAGGATAAGCTGAGGCAGGAGGG + Intronic
907385305 1:54121948-54121970 GAGCATAGGCAGAGCCAGGAGGG + Intergenic
908584706 1:65555007-65555029 GAGGGTGAGCTGAAGCAGGATGG - Intronic
908592788 1:65651826-65651848 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
908607720 1:65818399-65818421 GACAATAGGAAGAAGGAGGATGG - Intronic
908680784 1:66658929-66658951 GGGGAGAGGGAGAAGCAGCATGG + Intronic
909876690 1:80814013-80814035 GAGTATAGGCAGTAGAATGATGG - Intergenic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910330918 1:86071855-86071877 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
910543127 1:88383758-88383780 GAGGATAGGCAGAAGCAAAATGG - Intergenic
910827916 1:91428731-91428753 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
911434608 1:97840695-97840717 CATGAAAGGCAGAAGCATGAGGG + Intronic
911474302 1:98357442-98357464 GAGGGTAAGCAGCAGCAGCATGG - Intergenic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
911632570 1:100199742-100199764 GAGGGCCAGCAGAAGCAGGATGG + Intronic
911814759 1:102333144-102333166 CAGGATAGGAAGATGCAGGGTGG - Intergenic
912235253 1:107844165-107844187 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
912708090 1:111929685-111929707 GTAGAAAGGCACAAGCAGGATGG - Intronic
912883014 1:113437722-113437744 GAGGAAAGGAAGAAGAAAGAAGG - Intronic
912894948 1:113576453-113576475 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
912945199 1:114078856-114078878 GAGCAAAGGCAGAAGCAGACAGG - Intergenic
913102815 1:115584819-115584841 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
913159543 1:116132770-116132792 CAGAAGAGGCAGAAGCAGGGAGG + Intronic
913186598 1:116374367-116374389 GAGGATAGGCAGACCCACCAGGG + Intronic
913301874 1:117379637-117379659 GAGGCTAGGGGGAAGCAGGGAGG - Intronic
914457972 1:147854715-147854737 GAGGGCAAGCAGAAGCAGGGAGG + Intergenic
915061443 1:153188947-153188969 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
915100372 1:153495039-153495061 GAGGGCAGGCAGAGGAAGGAGGG - Intergenic
915314705 1:155021817-155021839 GAGGTTGGGCAGGAGCAGGGAGG - Intronic
915657640 1:157375020-157375042 TAGGGTGGGCAGATGCAGGAGGG - Intergenic
915711326 1:157902025-157902047 GAGGGTGGGCCGAAGCAGGCTGG + Intergenic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
916451921 1:164928887-164928909 GAGGATTGGCATGAGCAGGCAGG + Intergenic
916731678 1:167572196-167572218 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
916923379 1:169492315-169492337 GAAGACAGGCAGAGTCAGGAGGG - Intergenic
917023455 1:170614823-170614845 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
918109134 1:181440545-181440567 CAGGGTAGGCAGAGGCAGAAAGG + Intronic
918163278 1:181920580-181920602 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
918632154 1:186730806-186730828 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
918912604 1:190592847-190592869 GAGCAGAGGTAGAAGCAGGAGGG - Intergenic
919836138 1:201574781-201574803 GAGGATAAACAGAGGCAGGGAGG - Intergenic
919919532 1:202160033-202160055 GGGGATGGGCAGGAGGAGGAAGG - Intronic
920206977 1:204299350-204299372 GAGGACAGGAAGAAAGAGGAGGG + Intronic
920284378 1:204869005-204869027 GGGGAAAGGCACAACCAGGATGG - Intronic
920311967 1:205053927-205053949 GAGGAGAGGCAGAGGAAGGCTGG + Intronic
920764212 1:208816131-208816153 GAGGAAAAGGAGAAGCAGGGAGG - Intergenic
920892436 1:210002419-210002441 GAGGTTAAGCAAAAGCAGCAAGG - Intronic
920985508 1:210885255-210885277 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921461629 1:215433449-215433471 GAGGGCAAGCTGAAGCAGGATGG - Intergenic
921631261 1:217437077-217437099 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
922014410 1:221630506-221630528 GAGGAGGGACAGAAGCAGGGAGG + Intergenic
922066129 1:222145642-222145664 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922106333 1:222516603-222516625 GAGGACAGGCAGGGGCAGGAGGG + Intergenic
922126921 1:222736729-222736751 AAGGAAAGGTGGAAGCAGGAAGG + Intergenic
922555555 1:226529710-226529732 GATGAGTGGCAGAAGTAGGATGG + Intergenic
922715928 1:227872034-227872056 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922722753 1:227906888-227906910 GAGGCAAGGGAGAAGCAGAAGGG - Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923456066 1:234166673-234166695 CAGGATAGGAGGGAGCAGGAAGG + Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
923853345 1:237820368-237820390 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
924348513 1:243094168-243094190 GAGGAGAGGCAGGGGCAGGAGGG + Intergenic
924883390 1:248187685-248187707 GAGAGTGAGCAGAAGCAGGATGG + Intergenic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063056708 10:2512986-2513008 GAGGAAAGGAAGGAGCTGGAAGG + Intergenic
1063218115 10:3942371-3942393 GTGGAGAGGCAGCAGCAGGCTGG - Intergenic
1063935485 10:11073402-11073424 GAGGAATGGCAGTAGCAGCAGGG + Intronic
1063942352 10:11143108-11143130 GAGGAGAGGAAGAAGCACGAGGG - Intronic
1064896210 10:20240071-20240093 GAGGATAGAGGGAGGCAGGAGGG - Intronic
1065126524 10:22579501-22579523 GAGGATAGGGAGGAGCTGGAGGG - Intronic
1065821830 10:29532821-29532843 GAGGACAGGCAGGAGCGAGATGG - Exonic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1066727846 10:38410733-38410755 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1066965299 10:42258403-42258425 GAGGATATGGAGAAATAGGAAGG - Intergenic
1066993574 10:42540000-42540022 GAGGGTGAGCCGAAGCAGGATGG - Intergenic
1067279874 10:44863079-44863101 GAGAAAAGGCAGTGGCAGGAAGG + Intergenic
1067842025 10:49688640-49688662 GAGGATAGGCAGAAGCAGGAGGG - Intronic
1068122116 10:52791764-52791786 GAGGAGGGGGAGAAGGAGGAAGG + Intergenic
1068350059 10:55831426-55831448 GAGGTCATGCAGAAGCAGGGTGG - Intergenic
1068357188 10:55923806-55923828 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1068495306 10:57778992-57779014 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1068929898 10:62578861-62578883 AAGAATATGCAGGAGCAGGATGG + Intronic
1068933261 10:62612679-62612701 AAGGAGATGCAGAAGCAGGGGGG + Intronic
1069959364 10:72070548-72070570 GAGGGTGGGCAGGGGCAGGAAGG - Intronic
1069967777 10:72135699-72135721 GAGGCAGGACAGAAGCAGGAAGG + Intronic
1070213086 10:74347277-74347299 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1070349175 10:75575716-75575738 GAGGGTGAGCCGAAGCAGGAGGG + Intronic
1070538022 10:77393888-77393910 CAGGACCGGCAGAAGCAGGCCGG + Intronic
1070628568 10:78068221-78068243 GGGGACAGACAGAAGGAGGATGG + Intergenic
1070702465 10:78613557-78613579 GAGGAAAGGGGGAAGGAGGAAGG + Intergenic
1070756564 10:78997093-78997115 GAGGGTAGGAAGTAGCTGGATGG - Intergenic
1070837002 10:79454364-79454386 CAGGAAAGCCAGTAGCAGGAAGG - Intergenic
1070953193 10:80447117-80447139 GAGGATAAGCAGTTGCAGGAGGG - Intergenic
1070982166 10:80657748-80657770 TAGGAGAGGCAGATGCAGGTTGG - Intergenic
1071256571 10:83877170-83877192 GAGGAAAGTCAGAAGCAGCTTGG - Intergenic
1071397433 10:85237842-85237864 GAGAATGGGCAGAGGCAAGATGG + Intergenic
1072044795 10:91643987-91644009 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072493788 10:95934683-95934705 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1073340915 10:102743990-102744012 GAGGAGAGGGAGGAGGAGGAGGG + Exonic
1074015463 10:109529867-109529889 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1074290184 10:112132508-112132530 GAAGTTAGGAAGAAGCACGAGGG - Intergenic
1074532045 10:114304937-114304959 GAGGAAGTGCAGATGCAGGAGGG + Intronic
1074532055 10:114304973-114304995 GAGGGGACGCAGATGCAGGAGGG + Intronic
1074532092 10:114305087-114305109 GAGGGGACGCAGATGCAGGAGGG + Intronic
1074532103 10:114305123-114305145 GAGGGGACGCAGATGCAGGAGGG + Intronic
1074532185 10:114305411-114305433 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532189 10:114305429-114305451 GAGGGGACGCAGATGCAGGAGGG + Intronic
1074532198 10:114305465-114305487 GAGGGGACGCAGATGCAGGAGGG + Intronic
1074532235 10:114305603-114305625 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532241 10:114305639-114305661 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074532268 10:114305726-114305748 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074532292 10:114305816-114305838 GAGGGGAGGCAGATCCAGGAGGG + Intronic
1074532335 10:114305942-114305964 GAGGAGATGCAGATGCAGGGGGG + Intronic
1074532351 10:114305995-114306017 GAGGGGACGCAGATGCAGGAGGG + Intronic
1074532355 10:114306013-114306035 GAGGGGACGCAGATGCAGGAGGG + Intronic
1074532366 10:114306085-114306107 AAGGAGATGCAGATGCAGGAAGG + Intronic
1074532403 10:114306211-114306233 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074544619 10:114393072-114393094 AAGGAGAGGAGGAAGCAGGAAGG + Intronic
1074561884 10:114542520-114542542 GAAGAAAGGAAGAAGGAGGAGGG + Intronic
1075133695 10:119763320-119763342 GAGGATAGGAACAACCAGCAGGG - Intronic
1075175387 10:120155855-120155877 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1075198173 10:120379005-120379027 GAAGACAGGCAGAAACTGGAGGG - Intergenic
1075406207 10:122197451-122197473 GAAGTTAGGCAGAAGGAAGAAGG - Intronic
1075725137 10:124607121-124607143 GCGGAGAGGGTGAAGCAGGAGGG - Intronic
1076055408 10:127368376-127368398 CAGGACAGGAAGAAGCAGCAGGG - Intronic
1076163993 10:128267783-128267805 GAGGAAAGGAAGGAGGAGGAAGG - Intergenic
1076267383 10:129119340-129119362 GAGCATAGGCAGAAGCCACATGG + Intergenic
1076331732 10:129675309-129675331 GAGGTTAGGCAGATGCAGGCAGG + Intronic
1076475300 10:130747599-130747621 AAGGCTAGGAAGAAACAGGAAGG - Intergenic
1076676062 10:132148442-132148464 GAGGACGGGCAGATGGAGGACGG - Intronic
1076975085 11:165930-165952 GAGGAGAGGAAGGGGCAGGAGGG + Intergenic
1077219285 11:1408294-1408316 GAGGATCAGCAGGAGCTGGATGG - Intronic
1077280515 11:1742952-1742974 GAGGATGGACAGATGGAGGATGG + Intronic
1077280591 11:1743354-1743376 GAGGATGGACAGATGGAGGATGG + Intronic
1077557228 11:3231546-3231568 GAGGAGAGGGAGGAGAAGGAGGG + Intronic
1077799584 11:5524748-5524770 GAGGGTAGACAGAAACAGGGAGG - Intronic
1078060395 11:8039354-8039376 GGAGACAGGCAGAAGCTGGAAGG - Intronic
1078331567 11:10426377-10426399 GAGGACAAGCTGAAGCAGGGTGG - Intronic
1078429109 11:11274029-11274051 GAGGACAAGCTGAAGCAGGGTGG + Intronic
1079507176 11:21166192-21166214 GAAGATAGGGAGTAGAAGGATGG + Intronic
1079867821 11:25758137-25758159 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080709982 11:34737670-34737692 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1081118198 11:39231917-39231939 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1081165975 11:39809813-39809835 GAGCACAAGCAGAAGCAGGGTGG + Intergenic
1081252436 11:40851431-40851453 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1081282329 11:41225093-41225115 GAGGATAGAGAGTAGAAGGATGG + Intronic
1081339113 11:41905213-41905235 GAAGACAGGAAGAGGCAGGAAGG - Intergenic
1081691826 11:45083520-45083542 GAGGATAGACAGAGGCAGTGGGG + Intergenic
1081762317 11:45584967-45584989 GAGGACAGGCAGAAGAAGGTAGG - Intergenic
1082872225 11:57953829-57953851 GAGGTTGAGCAGAAGCAGGGTGG - Intergenic
1082876400 11:57992971-57992993 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1083254048 11:61485607-61485629 CAGGAGAGGGAGCAGCAGGAAGG - Intronic
1083331521 11:61900544-61900566 GAGGAGAGGCTGCGGCAGGAGGG + Intronic
1083499097 11:63087281-63087303 GAGGGCAGGCAGAAGCAGGGTGG + Intronic
1083503490 11:63133285-63133307 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1083506960 11:63167027-63167049 GAGGGTAAGCTGAAGCAGGGTGG + Intronic
1083510140 11:63201990-63202012 GAGGGTGAGCAGAAGCAGGTTGG + Intronic
1083927776 11:65818973-65818995 GAGGCTAGGCAGAAACAGAAAGG + Intergenic
1084667426 11:70583960-70583982 GAGGTTAGAGGGAAGCAGGAGGG - Intronic
1084687818 11:70707509-70707531 GTGGACAGACAGAGGCAGGAAGG + Intronic
1084911913 11:72396277-72396299 GAGAAAAGGCAGAAGGAGGGAGG + Intronic
1085407193 11:76270268-76270290 GAGGAGAGGCCGGAGCAGCAGGG - Intergenic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1087332119 11:96793521-96793543 GAGGACAAGCCGAAGCAGGGTGG - Intergenic
1087477231 11:98651344-98651366 GAGCATTGGCAGAAGCAAAAGGG + Intergenic
1087831057 11:102820212-102820234 GAGGGTAAGCAGGAGCAGGGTGG - Intergenic
1088078379 11:105879186-105879208 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1088687208 11:112295001-112295023 GAGAATAGGCAGAAGAGGAAGGG - Intergenic
1088702462 11:112425917-112425939 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1088707361 11:112475885-112475907 GAGGGTAGACAGAAGAAGGTGGG - Intergenic
1089364535 11:117913293-117913315 GAGGCTAGGCAGAATCATAAGGG - Intronic
1089766113 11:120766748-120766770 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1090330132 11:125924859-125924881 TAGGATAAGGAGAACCAGGATGG - Intergenic
1090347760 11:126084663-126084685 GCGGATGGGCAGGAGCAGGCTGG - Intergenic
1090349099 11:126095852-126095874 GAGGAAAGGCAGAACCAGAGAGG - Intergenic
1090553935 11:127853371-127853393 GAAAATAGGCAAAAGCATGAAGG - Intergenic
1090720326 11:129466893-129466915 GAGGGCGGGCAGAAGCAGGGTGG + Intergenic
1090779977 11:129999274-129999296 GGGGATAGGTAGAGGCAGGAGGG - Intronic
1090811620 11:130249640-130249662 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1091042458 11:132294612-132294634 GAGGACAGGAGGAGGCAGGAAGG + Intronic
1091140679 11:133231865-133231887 GAGGGGAGGGAGAAGCAGGCAGG + Intronic
1091198213 11:133749910-133749932 GAGGAGAGGGAGAAGAGGGAGGG - Intergenic
1091213613 11:133885545-133885567 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1091229878 11:133981377-133981399 CAGGAGAGGGAGAGGCAGGAAGG + Intergenic
1091995408 12:4989023-4989045 GCTGATAGGCAGAGGCAGAAAGG - Intergenic
1092141562 12:6187442-6187464 GAAGAAAGGAAGAAGAAGGAAGG + Intergenic
1092174066 12:6390946-6390968 GAGAAAAGGCAGAAGAAGGGGGG + Exonic
1092304277 12:7283398-7283420 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1092398876 12:8154208-8154230 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1092440320 12:8495749-8495771 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1092567777 12:9686143-9686165 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1092637479 12:10467195-10467217 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1092720165 12:11433259-11433281 GGGGGAAGGGAGAAGCAGGAAGG + Intronic
1092767657 12:11868066-11868088 GAAGTAAGGAAGAAGCAGGATGG - Intronic
1093491552 12:19710715-19710737 GAAGAGAGGTAGAAGCAGCAGGG + Intronic
1093744227 12:22721555-22721577 GAAGAGATGGAGAAGCAGGAGGG + Intergenic
1093772586 12:23034865-23034887 GAGGAAAGGAAGAAGGAGGGAGG - Intergenic
1093992927 12:25610310-25610332 GAGGGCAAGCTGAAGCAGGACGG - Intronic
1094571748 12:31647207-31647229 GAGGATAGGGTGAGGCAGGCTGG - Intronic
1095360632 12:41334234-41334256 AATGAAAGGCAGAAGCAAGAAGG - Intronic
1095396350 12:41766481-41766503 GAGGAGAGGAAGACACAGGAAGG - Intergenic
1095874789 12:47068571-47068593 GAGGAGGGGCAGAAGCCTGAGGG + Intergenic
1095920699 12:47526870-47526892 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1096238057 12:49943155-49943177 GAGGCTAGGGAGGGGCAGGAAGG + Intergenic
1096449952 12:51730887-51730909 GAGGATAGAAAGTAGAAGGATGG - Intronic
1096537670 12:52285954-52285976 GAGGAAGGGGAGAGGCAGGAAGG + Exonic
1096555994 12:52404194-52404216 GAGGATAGAGAGAGGCAGGCAGG - Intronic
1096665212 12:53159906-53159928 GAGGAAATGAAGAAGCGGGAAGG - Exonic
1096715189 12:53486946-53486968 GAGCACAAGCAGCAGCAGGAAGG - Exonic
1096795062 12:54071595-54071617 GAAGAGAGGCAGAAACAAGATGG + Intergenic
1097898884 12:64853786-64853808 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098464959 12:70776109-70776131 GTGGATAGGAAGAAGGAGAAAGG - Intronic
1099022610 12:77424846-77424868 GAGGATGAGCCGAAGCAGGGTGG - Intergenic
1099071449 12:78049504-78049526 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1099215190 12:79844794-79844816 GAGCAGAGGAAGAGGCAGGAAGG - Intronic
1099239015 12:80116345-80116367 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1099253801 12:80290186-80290208 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
1099536733 12:83855023-83855045 CAAGATAGGCAGATGTAGGAAGG + Intergenic
1099745056 12:86690608-86690630 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1100110967 12:91242411-91242433 GAGGGTATGCCGAAGCAGGGTGG + Intergenic
1100118132 12:91334626-91334648 GAGGAGAGGGAGAAGAAGGGAGG + Intergenic
1100291471 12:93218837-93218859 GAGGATAGGTTGAACCAGGGAGG - Intergenic
1100768822 12:97898597-97898619 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1101010100 12:100440707-100440729 GAGGAAAGGAGGAAGAAGGAAGG - Intergenic
1101426282 12:104591166-104591188 GAGGAGGGGCAGAGGCAGGCGGG + Intronic
1101824628 12:108210427-108210449 GAGGTGAGGCAGGGGCAGGACGG - Intronic
1101837738 12:108306997-108307019 GGGGAGAGGCACAAGCTGGATGG - Intronic
1101838381 12:108310838-108310860 GCGGGTAGGCAGAGACAGGAGGG + Intronic
1102955282 12:117054801-117054823 GAGGATGGCCAGAAAGAGGAAGG - Intronic
1103017346 12:117505782-117505804 CAGCATAGACAGAAGCAAGAAGG - Intronic
1103053386 12:117800183-117800205 GAAGAAGGGCAGAAGCCGGAGGG + Intronic
1103169238 12:118799447-118799469 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1103818087 12:123674965-123674987 GAGGATCGCCTGAACCAGGAAGG - Intronic
1104928696 12:132327246-132327268 GAGGACAGGAGGAAGCGGGATGG + Intronic
1105623454 13:22090746-22090768 TAGGAAAGTCAGACGCAGGATGG + Intergenic
1106042063 13:26103094-26103116 GAGGGCAAGCAGAAGCAGGATGG + Intergenic
1106336667 13:28789462-28789484 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1106429339 13:29665429-29665451 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1106874309 13:34055080-34055102 GAGGGTGAGCAGAAGCAGAATGG - Intergenic
1107333973 13:39333728-39333750 GAGGATATGGAGAAATAGGAAGG + Intergenic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1107645484 13:42490580-42490602 GTGGGGAGGGAGAAGCAGGAAGG + Intergenic
1108084352 13:46769673-46769695 AGGGACAGGCACAAGCAGGACGG - Intergenic
1108234961 13:48394097-48394119 GAGGGCAAGCTGAAGCAGGATGG + Intronic
1108274018 13:48789764-48789786 GAGGGCAGGAAGAAGGAGGAAGG + Intergenic
1108480706 13:50867422-50867444 GAAGAAAGAAAGAAGCAGGAAGG - Intergenic
1108546893 13:51503891-51503913 GAGGAAATGAAGGAGCAGGAAGG + Intergenic
1108593950 13:51934677-51934699 CAGGACAGCCAGCAGCAGGATGG - Exonic
1108698594 13:52924829-52924851 GAGGAGAGGCAAAAGCTGGAAGG + Intergenic
1108850197 13:54718706-54718728 GAGGACGAGCAGAAGCAGGGTGG - Intergenic
1108940488 13:55947500-55947522 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1109457570 13:62612017-62612039 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1110429264 13:75404899-75404921 GAGGATAAGCAGCAGCTGGTGGG - Intronic
1110824598 13:79957955-79957977 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1113399288 13:109976383-109976405 GAGGAGAGCCAGCAGCTGGAAGG - Intergenic
1113427423 13:110220675-110220697 AATGATAGTCAGAAGGAGGACGG - Intronic
1113545114 13:111142763-111142785 GAGGAGATGGTGAAGCAGGAGGG - Intronic
1113681652 13:112248704-112248726 GTGGAAAGACAGAAGCATGATGG - Intergenic
1113803810 13:113101807-113101829 GAGCAGAGGCAGGAGGAGGAGGG + Intergenic
1113981107 13:114276745-114276767 GAGGACAGGCTGCAGCAGGTAGG + Intergenic
1114482275 14:23043175-23043197 GAGGATGGGCAGCAGGGGGAGGG + Exonic
1114609728 14:24031213-24031235 GAGGATGTGGAGAAGTAGGAAGG + Intergenic
1114741672 14:25104411-25104433 GAGGGCGGGCAGAAGCAGGGTGG + Intergenic
1114844817 14:26308758-26308780 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1114875695 14:26715254-26715276 GAAGATAGGTAGAAGCAAAAAGG - Intergenic
1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG + Intergenic
1115281588 14:31668835-31668857 GAGGGTAGGCAGAAGCAGCGTGG - Intronic
1115357083 14:32460429-32460451 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1115447314 14:33506073-33506095 GAGGATAGGGAGTGGCAGGGTGG - Intronic
1115546018 14:34465374-34465396 GAGGATAAGCAAAATAAGGAAGG + Intergenic
1115591493 14:34869981-34870003 GAGGCTAGGCTGAGGCAGGTTGG - Intronic
1115680000 14:35727776-35727798 AAGGATATGTAGAAACAGGAAGG + Intronic
1116272848 14:42794770-42794792 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116416968 14:44689811-44689833 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1116416974 14:44689826-44689848 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1116416980 14:44689841-44689863 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1116565323 14:46438329-46438351 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116735886 14:48691075-48691097 GAGGAGTGGCAGAAGAAGAAGGG - Intergenic
1117025115 14:51611173-51611195 GAGGCTAGGGAGGAGCAGAAAGG + Intronic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117120976 14:52568149-52568171 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1117515090 14:56492813-56492835 GAGAATAAGCAGAAGTATGAAGG + Intronic
1117624134 14:57618382-57618404 GAGGGTAAGCAGAAGCAGGGTGG + Intronic
1117711868 14:58538751-58538773 GGAGATAGGCAGTAGAAGGATGG - Intronic
1117850145 14:59958904-59958926 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1118459528 14:65975954-65975976 GAGGAGAGGGAGGAGAAGGAGGG + Intronic
1118486753 14:66221684-66221706 GAGAAAAGGGAGATGCAGGAAGG - Intergenic
1119184628 14:72631184-72631206 GAATACAGGCAGAAGCAGCAAGG + Intronic
1120624964 14:86813768-86813790 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1120746171 14:88153842-88153864 GAGAGGAGGCAGGAGCAGGAAGG + Intergenic
1120809211 14:88785808-88785830 GAAGAGAGGCAGGGGCAGGATGG - Intronic
1121026649 14:90621145-90621167 GACGATAGGCAGAAGCCACATGG + Intronic
1121150348 14:91627723-91627745 GAGGAAAGCCTGAGGCAGGAGGG + Intronic
1121187623 14:91989900-91989922 AAGGAAAGTCACAAGCAGGATGG - Intronic
1121332353 14:93057692-93057714 GAGGAGAGGCAGAACCAGCAGGG + Intronic
1121845506 14:97169032-97169054 GAGGACAGGCAGCAGAAGGAGGG - Intergenic
1121939822 14:98059436-98059458 GGGGAGAGGGAGAAGTAGGAGGG + Intergenic
1122043627 14:99008159-99008181 GGGGAGAGGCAGAGGCAGGAGGG - Intergenic
1122137543 14:99643644-99643666 GGGAATAGGCAGAGCCAGGATGG - Intergenic
1122777902 14:104130876-104130898 GAGAAGAGGCAGGAACAGGAGGG + Intergenic
1122815824 14:104313267-104313289 GAGGATGTGGAGAAGCTGGATGG + Intergenic
1122837236 14:104436267-104436289 GATGTTATGGAGAAGCAGGACGG + Intergenic
1123083207 14:105705777-105705799 GAGGATTGGTAGACGGAGGATGG - Intergenic
1124421101 15:29523099-29523121 GAGGCTTTGCACAAGCAGGAAGG + Intronic
1124577001 15:30918610-30918632 GAGGGAAGCCAGCAGCAGGACGG + Intronic
1124718349 15:32088561-32088583 GAGGATGGGGAGCAACAGGAAGG - Intronic
1125003891 15:34796813-34796835 GAGGAGAGGGAGAAGGAAGAGGG + Intergenic
1125722977 15:41853944-41853966 GAGAAGAGGCTGAAGCAGGCTGG + Intronic
1126122602 15:45267264-45267286 GAAGTAAGGCAGAAGCTGGATGG + Intronic
1126715440 15:51511552-51511574 GAGGATGTGGAGAAACAGGAAGG + Intronic
1126950718 15:53877591-53877613 GAGAATAGGGAGGAGGAGGAGGG + Intergenic
1127137968 15:55944158-55944180 GAGGGCAAGCCGAAGCAGGATGG + Intronic
1127637874 15:60888682-60888704 GAGGAGAGCCAGAAACAGCAGGG - Intronic
1128560943 15:68667308-68667330 AAGCAGAGGAAGAAGCAGGATGG - Intronic
1128857595 15:71032273-71032295 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1129379065 15:75154226-75154248 GAGGATTGGGAGAAGAAAGAGGG - Intergenic
1129600356 15:76995015-76995037 AAGCAGAGGCAGGAGCAGGATGG + Intronic
1130310506 15:82749789-82749811 GAAGCTAGGAAGAGGCAGGAAGG + Intergenic
1131291714 15:91112147-91112169 GGGGATAGGGAGAAGGGGGATGG + Intronic
1131565842 15:93484635-93484657 GAGGATAGGCAGAACCAAAATGG + Intergenic
1132028069 15:98419644-98419666 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
1132219559 15:100095142-100095164 AAGGAGAGGCAGGAGCAGGTTGG - Intronic
1132659272 16:1054298-1054320 GAGGGTGGGCAGCACCAGGAGGG - Intergenic
1132894228 16:2220314-2220336 GGGCTTAAGCAGAAGCAGGAAGG - Intergenic
1133448050 16:5879276-5879298 GATGGTAAGCAGAAGCTGGAGGG + Intergenic
1134851183 16:17480295-17480317 GAGGAAAGTCAGAGGCAGGAGGG - Intergenic
1135694706 16:24575793-24575815 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694758 16:24575915-24575937 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1136007486 16:27340952-27340974 GAGGAGAGTGAGCAGCAGGAGGG + Intronic
1136064221 16:27747845-27747867 GAAGAAAGGAAGAAACAGGAAGG - Intronic
1136479630 16:30533447-30533469 CAAGAAAGGCAGAACCAGGAGGG + Intronic
1136483408 16:30556406-30556428 CAAGAAAGGCAGAACCAGGAGGG + Intronic
1136521631 16:30800357-30800379 GGGGCTGGGCAGAAGCAGGAGGG + Intergenic
1137255149 16:46769023-46769045 GAGGAGAGAGAGAAGCAGGTGGG - Intronic
1137290438 16:47048867-47048889 GAGGCCAGGCAGCAGCAGGAAGG + Intergenic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1138151468 16:54661507-54661529 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1138706534 16:58920936-58920958 GAAGACAAGCAGAAGCAGGGTGG - Intergenic
1138886830 16:61090613-61090635 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1139350347 16:66331141-66331163 GAGGATATGCAGAATAAGAAGGG + Intergenic
1139531341 16:67544139-67544161 GAGGATTTCCAGAAGGAGGAAGG - Intronic
1139569390 16:67801379-67801401 GGGGAAAGGCAGCAGCAGCATGG + Intronic
1139744651 16:69064483-69064505 GAAGATAGGGAGCAGCAGAAAGG - Intronic
1139811733 16:69624605-69624627 GTGGATAGGGATAAGGAGGAAGG - Intronic
1141498834 16:84429677-84429699 GAAGAGAGGCAGAGGCAGGTGGG + Intronic
1141514578 16:84535154-84535176 GAGGAGTGGGAGAAGGAGGAGGG - Intronic
1141666020 16:85465578-85465600 GACGGTAGGGAGAGGCAGGAAGG - Intergenic
1142445178 16:90131729-90131751 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1142462331 17:103737-103759 GAGGAGAGGCAGGGGTAGGAGGG + Intergenic
1142599589 17:1047144-1047166 TAGGAAAGGCAGGAGGAGGAGGG - Intronic
1142674517 17:1505478-1505500 GAGGCCAGGCTGCAGCAGGATGG - Intronic
1142897719 17:2992744-2992766 GAGGAAAGGAAAAAGAAGGAAGG - Intronic
1142930547 17:3280699-3280721 GAGGATGGGAAGCAGCTGGAGGG + Intergenic
1143361127 17:6372186-6372208 GAGGAGAAGAAGCAGCAGGAGGG + Intergenic
1143512988 17:7405979-7406001 AGGGATAGGGAGAAGGAGGAGGG + Intronic
1143870279 17:9953310-9953332 AAGGAGTGGCAGAAGCAGCAGGG - Intronic
1144434202 17:15224397-15224419 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1145764291 17:27447812-27447834 GAGAAAGGGCAGAAGCTGGAAGG + Intergenic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1146000942 17:29129958-29129980 GAGGAAAGCCAGAAGAGGGAGGG - Intronic
1146519335 17:33514358-33514380 GAGGATGGGGAGATGGAGGAAGG - Intronic
1146742743 17:35300995-35301017 GAGGGTAAGCCAAAGCAGGATGG + Intergenic
1146746419 17:35334220-35334242 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1146908635 17:36633644-36633666 GAGGAAGGGGAGAAGGAGGAGGG + Intergenic
1148000201 17:44383400-44383422 GAGGGCAGCCAGAACCAGGATGG - Intronic
1148218432 17:45846536-45846558 GGCTCTAGGCAGAAGCAGGAGGG + Exonic
1149107083 17:52982591-52982613 GAGGAGGGGGAGAAGGAGGAAGG - Intergenic
1149192926 17:54085790-54085812 GAAGATGAGCTGAAGCAGGATGG + Intergenic
1149281358 17:55108703-55108725 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1149365373 17:55938837-55938859 GAGGGTGAGCAGAAGCAGGTTGG + Intergenic
1149535299 17:57429107-57429129 GAGGACACGCAGATCCAGGAAGG - Intronic
1149865476 17:60149005-60149027 GAGGACCTGCAGTAGCAGGAGGG + Intergenic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1150893059 17:69177011-69177033 GAGGATATGCAGAAGAGAGATGG - Intronic
1151362967 17:73599625-73599647 GAGGAAAGGATGAAGAAGGAGGG + Intronic
1151441467 17:74132078-74132100 GAGGAGCAGCAGAAGCGGGAAGG - Intergenic
1151761091 17:76103628-76103650 GAGGACAAGCTGAAGCAGGTGGG - Exonic
1152143127 17:78550301-78550323 GAGGACAGGCTCATGCAGGAAGG + Intronic
1152230972 17:79114002-79114024 GAAGAAAACCAGAAGCAGGAGGG - Intronic
1152297513 17:79476722-79476744 GAGGATAGGCAGAGGCAGGGTGG + Intronic
1152328044 17:79653669-79653691 AAGAATAGGCAGAAGTAGGAAGG + Intergenic
1152913082 17:83016625-83016647 GAGGAGGGACAGAAGAAGGAGGG + Intronic
1153119114 18:1700113-1700135 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1153359879 18:4182231-4182253 AAGAACAAGCAGAAGCAGGAAGG + Intronic
1153798378 18:8646574-8646596 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1153987778 18:10368551-10368573 GAGGAGAGGGAGAGGGAGGAAGG + Intergenic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155341843 18:24821067-24821089 GAGGCTAGGAAGAGGCAGGAGGG - Intergenic
1155546772 18:26923979-26924001 GATGACAGGGAGAGGCAGGAGGG + Intronic
1155659333 18:28228969-28228991 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
1155759054 18:29541369-29541391 GAGGAGAGGGAGAAAGAGGAAGG - Intergenic
1155857432 18:30850569-30850591 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1156197423 18:34790954-34790976 GAGAATAGGCAGCGGGAGGATGG + Intronic
1156787313 18:40931362-40931384 GAGGTAAGGCAGAAGAAGGGAGG - Intergenic
1157449225 18:47772895-47772917 GTGCAGAGGCTGAAGCAGGAAGG + Intergenic
1157462952 18:47917883-47917905 GAGGATAGGGAGAAGAGGTAAGG + Intronic
1158322479 18:56278866-56278888 GAGGATGGGCAAAAGCACGAAGG - Intergenic
1160200886 18:76794298-76794320 GGGGACAGGAAGAAGCAGCATGG - Intergenic
1160652037 19:236113-236135 GAGGAGAGGAAGGGGCAGGAGGG + Intergenic
1160829834 19:1098589-1098611 GAGGGGAGGCAGCAGCAGGAGGG + Intergenic
1161167360 19:2795446-2795468 GAGGATGAACAGCAGCAGGAGGG - Intronic
1161370622 19:3908902-3908924 GAGGATGGGGAGGAGGAGGATGG - Intronic
1161431112 19:4233022-4233044 AAGGAGAGGCAGGAACAGGAGGG - Intronic
1161517985 19:4707355-4707377 AGGGAATGGCAGAAGCAGGATGG + Intronic
1161571730 19:5034566-5034588 AAGGCTATACAGAAGCAGGAAGG + Intronic
1161643367 19:5437303-5437325 GAGGGTAGGCAGAGGCAGGAGGG + Intergenic
1161740917 19:6020713-6020735 CAGGAAAGGCAGCAGCTGGACGG + Intronic
1162053096 19:8046815-8046837 GAGGAGGGGGAGAAGGAGGAGGG - Intronic
1162323874 19:9986858-9986880 GAGGCTAGGCAGAAGCTGGGAGG + Intronic
1162787697 19:13045928-13045950 GAAGATACGCAGAAATAGGAAGG + Intronic
1163050499 19:14679747-14679769 GTGGAAAGGCTGAAGCAGAAGGG - Intronic
1163176746 19:15569551-15569573 GATGAGAGGCAGAAGAAAGAGGG + Intergenic
1163288871 19:16365678-16365700 GAAGCTGGGCAGAAGCAGGCAGG - Intronic
1163609320 19:18292830-18292852 GAGGGGAAGCTGAAGCAGGAAGG - Intergenic
1163690897 19:18737726-18737748 GAGGAGGAGCAGCAGCAGGAGGG - Intronic
1163786758 19:19278819-19278841 GAGAAGAGGGAGAAGCAGGAAGG + Intronic
1165136222 19:33671378-33671400 GAGGCCAGGCAGAAACAGGTTGG - Intronic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1165255827 19:34576843-34576865 GAGTAGAGGCAGCAGCAGGGCGG + Intergenic
1165446955 19:35861743-35861765 GAGGGGAGGAAGAAGCAGGAGGG - Intronic
1165488678 19:36110885-36110907 GAGGATAGGAAGAAGAAACAAGG - Intergenic
1165773197 19:38389965-38389987 GGTGATAGGGATAAGCAGGAGGG + Intronic
1166502450 19:43352344-43352366 GAGGAGAAGCAGAAGAGGGAAGG - Intergenic
1166546660 19:43638459-43638481 GTGGCTAGGCAGAAGCAGGAGGG - Intronic
1167251370 19:48400010-48400032 GAGGATGGGCAGGAGGATGAAGG + Intronic
1167286671 19:48602292-48602314 GAGGTGAGGAAGAGGCAGGAAGG + Intronic
1167600377 19:50451387-50451409 GAGGATAGGCAGGGCGAGGAAGG + Intronic
1167608258 19:50493209-50493231 GAGGAGAGGTAGAAGGAGAATGG + Intergenic
1167727422 19:51225766-51225788 GAGGGGATGCAGAATCAGGAGGG - Intronic
1167766174 19:51484006-51484028 GGAGATAGGCAGCAGCAGAATGG - Intronic
1168159443 19:54499603-54499625 AAGAAGAGTCAGAAGCAGGAAGG + Intronic
1168181619 19:54665860-54665882 GAGGAGGGAGAGAAGCAGGATGG - Exonic
924989029 2:295429-295451 GAGGGTGGGCAGAAGGAGGCAGG - Intergenic
925402563 2:3586022-3586044 GAGGAGAGGAAAAAGGAGGAGGG + Intergenic
925618138 2:5763483-5763505 GAAGAATGGCAGAATCAGGAGGG - Intergenic
925718432 2:6806287-6806309 GGGTGAAGGCAGAAGCAGGAAGG - Intergenic
925957049 2:8977034-8977056 GAGGCCAGGGAGAGGCAGGAGGG + Intronic
926052672 2:9754723-9754745 GAGGGTGGGCAGGGGCAGGAGGG + Intergenic
926083945 2:10009702-10009724 GGAGAGAGGCAGAGGCAGGAAGG - Intergenic
926143482 2:10382842-10382864 GTGGCTGGGCAGAAACAGGAAGG - Intronic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926714509 2:15913573-15913595 GAGGCTAGGCAGAGGGAGGGAGG + Intergenic
926970680 2:18464164-18464186 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
927045438 2:19273475-19273497 GAGCAGAGGCAGATCCAGGATGG + Intergenic
927088150 2:19690460-19690482 GAGGGGAGGGAAAAGCAGGAAGG + Intergenic
927182715 2:20458450-20458472 GAGGGTGAGCAGAAGCAAGATGG + Intergenic
927518660 2:23686523-23686545 GAGGATGGGCAGGACCAGGACGG + Intronic
927904127 2:26845235-26845257 GAGGACGTGCTGAAGCAGGAAGG + Intergenic
927930359 2:27039861-27039883 GAGGAGAGGCAGAAGAGAGAAGG + Intronic
927946669 2:27138856-27138878 GAGGAGAGGAATAAGGAGGAAGG + Intronic
928924673 2:36565573-36565595 GAGGTCAGGTAGAAGGAGGAGGG - Intronic
929180319 2:39030999-39031021 GAAGCTAGGCAGAGGCAGCAGGG + Intronic
929256220 2:39813973-39813995 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929483916 2:42338285-42338307 AAGGAAAGGCAGAGGCTGGATGG - Intronic
929837934 2:45425661-45425683 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
929971360 2:46580034-46580056 GGGCATAGACAGAAGCAGAAAGG - Intronic
930223386 2:48767867-48767889 GAGGGCAGGCAGAAGCAGGGTGG - Intronic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930664724 2:54090662-54090684 CAGGATTGGCAAAGGCAGGAAGG - Intronic
930679820 2:54245031-54245053 GAGGATAGGGAGATGGGGGAAGG - Intronic
930908959 2:56606797-56606819 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
930951248 2:57146391-57146413 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
931634476 2:64329192-64329214 CGGGAAACGCAGAAGCAGGAAGG - Intergenic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933299239 2:80523947-80523969 TAGGATAGGCAGAGGTAGAAGGG + Intronic
933409886 2:81911744-81911766 GAGGAAAGGAAGAAAGAGGAGGG - Intergenic
933880387 2:86663829-86663851 GAGGGTGGGCTGAAGCAGGGTGG + Intronic
934314736 2:91906842-91906864 GAGGATATGGAGAAATAGGAAGG + Intergenic
934511747 2:94950060-94950082 GAGGATGTGGAGAAACAGGAAGG - Intergenic
934564337 2:95330126-95330148 GAGAAGAGGCAGGAGCAGGAAGG + Intronic
934579394 2:95426524-95426546 AAGGAAAGGGAGATGCAGGACGG - Intergenic
934600049 2:95650200-95650222 AAGGAAAGGGAGATGCAGGACGG + Intergenic
934616094 2:95772192-95772214 GAAGAGAAGCAGAGGCAGGAGGG - Intergenic
934644802 2:96052368-96052390 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
934838213 2:97608457-97608479 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
935369908 2:102334303-102334325 GAGGATTGGGTGAAGCAAGAAGG + Intronic
935403475 2:102684255-102684277 GAGGAAACACAGCAGCAGGAAGG - Exonic
935760855 2:106319386-106319408 GAGAAATGGCGGAAGCAGGAAGG + Intergenic
935818437 2:106869570-106869592 GAGCAAAAGCAGCAGCAGGAGGG - Intronic
935982724 2:108643343-108643365 GAGGATGAGCCGAAGCAGGGTGG + Intronic
936255094 2:110904440-110904462 CAGGAAAGACAGAGGCAGGAGGG - Intronic
936657520 2:114505513-114505535 GAGGAACAGCAGATGCAGGAAGG - Intronic
936900037 2:117472340-117472362 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
937321869 2:120965803-120965825 GAGGACAGAAAGAAGCAGGGAGG - Intronic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937465104 2:122125442-122125464 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
937807205 2:126160627-126160649 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
937810006 2:126188611-126188633 GAGGAAAGGAAGAAGCAAAAAGG + Intergenic
938144658 2:128823534-128823556 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
938224357 2:129602877-129602899 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
939180306 2:138795794-138795816 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
939937848 2:148313935-148313957 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
939945317 2:148402514-148402536 GAAGATGGGGAGAAGTAGGAGGG - Intronic
940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG + Intergenic
940565240 2:155351827-155351849 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
940771236 2:157841363-157841385 GGGGATAGGATGAAGCAGGGGGG + Intronic
940995800 2:160148620-160148642 GAGGGTGAGCAGAAGCAGGGCGG + Intronic
941239471 2:163017909-163017931 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
941682420 2:168413339-168413361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
942232529 2:173873621-173873643 GTGGATAGGTTGGAGCAGGAAGG + Intergenic
942327400 2:174787703-174787725 GAGGATAGGAAGAAGGGGCAGGG - Intergenic
942395758 2:175547777-175547799 GAGGGTCTGCATAAGCAGGAAGG - Intergenic
942431380 2:175914596-175914618 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
942602801 2:177658454-177658476 GAGGAGAGGCAGAGGAGGGAAGG - Intronic
942898673 2:181089066-181089088 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
943147767 2:184066433-184066455 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
943716741 2:191160715-191160737 GAGGACAAGCCGAAGCAGGGTGG + Intergenic
944267820 2:197748093-197748115 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
944764265 2:202848983-202849005 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
944927672 2:204481599-204481621 GAAAATAGGAAGTAGCAGGAAGG - Intergenic
945040353 2:205738771-205738793 GAGGAGAGGGAGCAGCAGGCTGG + Intronic
945210968 2:207381467-207381489 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
945927326 2:215819167-215819189 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
946110130 2:217407806-217407828 GAGGACAGGTAGCAGCAGGGTGG - Intronic
946172994 2:217906306-217906328 GTGGATGGGGAGAAGAAGGATGG - Intronic
946276883 2:218638359-218638381 GGGGAGCGGCAGGAGCAGGAGGG + Exonic
946372713 2:219290422-219290444 GAGGAGGCGCAGAAGCAGGTGGG + Intronic
946907578 2:224431187-224431209 GAGAAAATGCAGAAGAAGGAAGG + Intergenic
946912904 2:224484978-224485000 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
946996660 2:225400321-225400343 GAGGAGAAAGAGAAGCAGGAAGG + Intergenic
947171499 2:227317250-227317272 GAAGATGGTCAGAAGCAGGGTGG + Intergenic
947364595 2:229381118-229381140 GAGGGCGAGCAGAAGCAGGATGG + Intronic
947650543 2:231782493-231782515 GGGGACAGGCAGAGGAAGGAAGG - Intronic
947702861 2:232249655-232249677 GAGGATTGGCAAAGGCAGGAGGG + Intronic
949049293 2:241888571-241888593 GAGGATGGGAGGAAGCAGGTGGG - Intergenic
1168771791 20:420652-420674 GGGGATGGGCAGGAGCAGGCAGG - Intronic
1168938711 20:1690759-1690781 GAGGGTAAGCAGAAGCAGGGTGG + Intergenic
1168967328 20:1906754-1906776 GAGGTGAGGCAGAGGCAGGGAGG + Intronic
1169348251 20:4846965-4846987 GAGGATGGGCAGAAGGAGAGGGG + Intergenic
1169354397 20:4895310-4895332 GAGGAAAGGCAGATGCAGCCGGG - Intronic
1169537819 20:6564766-6564788 GAGGAATGGGAGAAGCAGGATGG - Intergenic
1169669370 20:8078664-8078686 GGGGAGAGGCAGACACAGGAAGG - Intergenic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170150737 20:13222809-13222831 GAGCATAGGCAAAAGCAAGCAGG + Intronic
1170322004 20:15110474-15110496 GATGAAAGACAGAAGCAGGAAGG + Intronic
1170357368 20:15507319-15507341 GGGAATTGGGAGAAGCAGGAAGG - Intronic
1170594324 20:17793848-17793870 GAGGCTGAGCAGAGGCAGGATGG - Intergenic
1170727425 20:18942151-18942173 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
1170766359 20:19292668-19292690 GTTGAGAGGCAGAAGCAGGTGGG + Intronic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1171152717 20:22842078-22842100 GATGAGAGCCAGAAGCAGAAGGG - Intergenic
1171227885 20:23456552-23456574 GAGGCTGGGCAGAGGCAGGAAGG - Intergenic
1171336980 20:24393756-24393778 GAGGAGAGGCAAGAGCAGAAGGG + Intergenic
1172014651 20:31865857-31865879 GATGCTTGGGAGAAGCAGGAAGG + Intronic
1172474867 20:35228952-35228974 GAGGGAAGGGGGAAGCAGGATGG - Intronic
1172550118 20:35792544-35792566 GAGGAAAGGCAGAAGAGGTAAGG - Intronic
1172858827 20:38031144-38031166 GTGCAAAGGTAGAAGCAGGAAGG - Intronic
1172946118 20:38690783-38690805 GATGATTGGCAGATGGAGGAAGG - Intergenic
1173034338 20:39394359-39394381 GAAGATATGCAGGAGGAGGAGGG + Intergenic
1173360254 20:42337823-42337845 GAGGAAAAGCAAAGGCAGGACGG + Intronic
1174554003 20:51381157-51381179 GAGGACAGGCAGAAGGGGAAAGG + Intergenic
1175149136 20:56919334-56919356 GAGAAAAGGCAGATGCAGAAAGG - Intergenic
1175260859 20:57673229-57673251 GAGAATGGGCAGCAGGAGGAGGG - Intronic
1175423354 20:58849852-58849874 TAGGAAAAGCAGAAGCAGCATGG - Intronic
1175754858 20:61523021-61523043 GAGCAGAGGAAGGAGCAGGAGGG + Intronic
1176891697 21:14327002-14327024 GAGGGCACGCAGAAGCAGGGTGG + Intergenic
1176928413 21:14779046-14779068 GAGGGTGGGCCAAAGCAGGATGG + Intergenic
1178998456 21:37430005-37430027 GAGGATCGGGAGAAACTGGATGG - Intronic
1179725388 21:43338859-43338881 GAGGGTCTGCAGAAGCAGGCGGG + Intergenic
1180073534 21:45450403-45450425 TAGGGTGGCCAGAAGCAGGAGGG + Intronic
1180540968 22:16447367-16447389 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
1180985722 22:19903053-19903075 GAGGACAGACAGCAGCAGGCTGG + Intronic
1180990108 22:19930588-19930610 AAGGACAGGGACAAGCAGGAGGG + Intronic
1181116377 22:20634696-20634718 GGAGACAGGCAGAAGCAGGAGGG + Intergenic
1181408709 22:22703214-22703236 AAGGAAAGGCAGAGGCAGGAGGG - Intergenic
1181413982 22:22746343-22746365 AAGGAAAGGCAGAGGGAGGAGGG - Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181528855 22:23504703-23504725 GAGGAGAGGCAGAAGCTGGGAGG + Intergenic
1182128939 22:27836545-27836567 GAGGGTGGGCCGAAGCGGGAGGG - Intergenic
1182575678 22:31271328-31271350 GGGCATTGGAAGAAGCAGGAAGG - Intronic
1182920041 22:34070905-34070927 GAGGTTATGCAACAGCAGGATGG + Intergenic
1183404842 22:37625295-37625317 GAGGACAGGCAGAAGAAGGAAGG + Intronic
1183442266 22:37830026-37830048 GAGGGGAGGCAGGGGCAGGAGGG - Intergenic
1183501309 22:38181281-38181303 GAGGAAAGGCAGGAGAAGCAGGG + Intronic
1183646454 22:39129886-39129908 GAGGCTAGGCTGGAGCAGGCAGG - Intronic
1184184298 22:42854128-42854150 GATGAAGGGCAGATGCAGGACGG - Intronic
1184258520 22:43301255-43301277 GAGGATGGACAGAGGCAGGATGG - Intronic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1184983552 22:48113908-48113930 GAGCATAGGTAGTGGCAGGAAGG - Intergenic
1185078520 22:48696307-48696329 GAGGATAGGAAGGGACAGGAAGG - Intronic
1185089403 22:48757323-48757345 GAGGATGGGAAGGAGGAGGAGGG + Intronic
949423601 3:3891902-3891924 GAGGATGTGCTGAAGCAGGATGG - Intronic
949456671 3:4246232-4246254 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
949632613 3:5944545-5944567 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
949803966 3:7934332-7934354 GAGGACAAGCTGAAGCAGGGCGG + Intergenic
949954967 3:9259995-9260017 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
950108304 3:10402293-10402315 AAGGAGAGGCAGAGGCAGGTTGG - Exonic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950490824 3:13303935-13303957 GAGGATAGGGATGATCAGGATGG - Intergenic
950856206 3:16107748-16107770 GAGAAGAGGCAGAACCAGCAAGG - Intergenic
950991945 3:17449082-17449104 GAGGGTGAGCAGAAGCAGCATGG + Intronic
951135879 3:19103707-19103729 GAGGATGAGCAGAATCAGGGTGG - Intergenic
951254582 3:20433409-20433431 GAGGACGAGCAGAAGCAGGGTGG - Intergenic
951676521 3:25247616-25247638 GAGGATGAGCAGAAGCAGGGTGG - Intronic
951741600 3:25931326-25931348 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
951826584 3:26875657-26875679 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
952165101 3:30739322-30739344 GAGGATGGGCACAGGAAGGAGGG - Intronic
952308240 3:32164168-32164190 GGGGAAAGGGAGAAGCAGGTTGG + Intronic
953036570 3:39216834-39216856 GACGAAAGGCAGTAGCTGGAGGG - Intergenic
953102438 3:39842755-39842777 GAGGGCAGACAGAAGCAGGGGGG - Intronic
953315777 3:41925248-41925270 GAGGGCAGGCAGAAGCAAGGTGG + Intronic
953431493 3:42844250-42844272 GAGGTGAGGCAGAGGAAGGAAGG + Intronic
953554726 3:43935065-43935087 GAGGATATGGAGAAATAGGAAGG - Intergenic
953555867 3:43946353-43946375 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
953793012 3:45962722-45962744 GAGGATGGGCAGGAGGAGAAAGG + Intronic
953822753 3:46222405-46222427 GAGGCAAGGCAGCAGCAAGAGGG - Intronic
954436723 3:50500238-50500260 GAGGGTGGGCAGAAGCAGTGAGG - Intronic
954450939 3:50571353-50571375 GAGGACAGGAAGAGGGAGGAGGG + Intronic
954456699 3:50603487-50603509 GAGGATGGGGAGATTCAGGAGGG - Intergenic
954847617 3:53573577-53573599 GTGGATAGGGAGAAGCACAAAGG - Intronic
954929121 3:54265213-54265235 GAGGATGTGGAGAAACAGGAAGG - Intronic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
956048384 3:65220701-65220723 GAGGATGAGCGGAAGCAGGGTGG - Intergenic
956570728 3:70691377-70691399 GAGGATGTGGAGAAGTAGGAAGG - Intergenic
956643357 3:71435146-71435168 GAGGAGAGGAAGGAGAAGGAGGG + Intronic
956753497 3:72363648-72363670 GAGGATGGGCAGAAGGAATAAGG + Intergenic
957218816 3:77355513-77355535 GAGGATAGGTCACAGCAGGAAGG + Intronic
957272618 3:78051345-78051367 GTGGGGAGGCAGAGGCAGGAGGG - Intergenic
957463035 3:80547143-80547165 GAACATAGGCAGTAGAAGGATGG - Intergenic
957954354 3:87164720-87164742 GAAGATTGGCAGAAGCAGAATGG - Intergenic
957959244 3:87227710-87227732 GAGGTGAGTCAGAAGCAAGAGGG - Intronic
958171565 3:89945873-89945895 TAGGATAGGCAGGCCCAGGAGGG + Intergenic
958479685 3:94630772-94630794 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
959345664 3:105191471-105191493 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
959453689 3:106533909-106533931 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
960198179 3:114796728-114796750 TAGGATAGTCAAAAGCAGGATGG + Intronic
960248353 3:115424746-115424768 GAGGATTGGCTGCAGCGGGAAGG - Intergenic
960760163 3:121064267-121064289 GAGGAGGAGCAGAAGCAGGGTGG - Intronic
960773236 3:121217477-121217499 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
961230595 3:125304071-125304093 GAGGATAGGCAAGAGCAGGAAGG - Intronic
961345472 3:126260732-126260754 GAGGAAGGGAAGAAGAAGGAAGG - Intergenic
961416554 3:126763180-126763202 GGGGAAAGGAAGAAGCAGAAAGG - Intronic
962007012 3:131359874-131359896 GAGGTGAGGCAGAAGCAGAGAGG + Intergenic
962156763 3:132956549-132956571 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
962391290 3:134974944-134974966 GAGGATGGGCAGTGGCAGGGAGG - Intronic
962491363 3:135897002-135897024 GAGGAAAGGGAGAGGGAGGAAGG - Intergenic
962784771 3:138757643-138757665 GAGGAGAGGGAGAGGAAGGAGGG + Intronic
962889902 3:139662506-139662528 GAGGGTAGGCAGTAGCATTAGGG + Intronic
962911435 3:139855121-139855143 GAGGATAGGAAGAAAGAGAAAGG - Intergenic
963048531 3:141122914-141122936 GAGGGCAAGCGGAAGCAGGACGG - Intronic
963065028 3:141256842-141256864 GAGGAGAGCCAGAAGTGGGAGGG + Intronic
963130004 3:141849214-141849236 GCTGATAAGGAGAAGCAGGACGG + Intergenic
963629376 3:147713457-147713479 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
963863613 3:150336179-150336201 GAGGATATACAGAAGGAGGTGGG - Intergenic
964159592 3:153630902-153630924 GAGGAGGGGTAGAAGCAGCAGGG + Intergenic
964274413 3:154993910-154993932 GAGGACAGGTAGAGGAAGGAAGG + Intergenic
964391325 3:156201110-156201132 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
964554709 3:157923949-157923971 GAGGGTAGACAGTAGAAGGAGGG - Intergenic
964904752 3:161706934-161706956 GAGGGTGGACAGAAGCAGGGTGG + Intergenic
965439382 3:168694006-168694028 GAGGAGAAGTAGCAGCAGGAGGG + Intergenic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
965611359 3:170547131-170547153 GAGGAAAAGGAGAAGAAGGAAGG - Intronic
966309322 3:178576191-178576213 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
967068057 3:185938091-185938113 GAGGAAAGGCAGAGCGAGGAGGG - Exonic
967419653 3:189259293-189259315 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
968365794 3:198183859-198183881 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
968617476 4:1584785-1584807 GAGGACAGGCAGAGGCTGCATGG + Intergenic
968925454 4:3544886-3544908 GAGGCCAGGCAGAAGCAGCATGG + Intergenic
969455425 4:7297327-7297349 GAGGACAGGCAGAGGCAGAAGGG - Intronic
969911141 4:10447540-10447562 GAGGAGAGGCTGGAGCAGAAAGG + Intronic
970214605 4:13745665-13745687 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
970233310 4:13933145-13933167 GTTGGAAGGCAGAAGCAGGAGGG + Intergenic
970679290 4:18489024-18489046 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
971961703 4:33496477-33496499 GAGGATGGGAATATGCAGGATGG - Intergenic
972260945 4:37407878-37407900 GAGGGCGAGCAGAAGCAGGATGG + Intronic
972372531 4:38438493-38438515 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
972886159 4:43491352-43491374 GAGGCCAGGCCGAGGCAGGATGG + Intergenic
972962661 4:44473557-44473579 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
973529337 4:51819234-51819256 GGGGACAGCCAGAAGAAGGATGG + Intergenic
973629023 4:52801797-52801819 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
974020473 4:56688086-56688108 GAGGATGAGGAGAAGAAGGAAGG + Intergenic
974264060 4:59560900-59560922 GAGGGCAAGCAGAAGCAGGTGGG - Intergenic
974323535 4:60385358-60385380 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
974491717 4:62572211-62572233 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
975149506 4:71005260-71005282 GAGGCCAAGCAGAAGCAGGGTGG - Intronic
975289147 4:72656643-72656665 GAGGATATGGAGAAATAGGAAGG + Intergenic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
975524168 4:75331146-75331168 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
975638700 4:76477821-76477843 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
976362981 4:84202471-84202493 GAGGGCCAGCAGAAGCAGGATGG + Intergenic
976580557 4:86730776-86730798 GAGGATGAGCTGAAGCCGGACGG - Intronic
976585337 4:86791014-86791036 GAGGGTGGGCTGAAGCAGGGTGG + Intronic
976635111 4:87279564-87279586 GAGGAGAGGCAGAATGAGGCGGG + Intergenic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977536880 4:98263809-98263831 GGGGATAAGCAGAAACAGAAAGG + Intronic
977792852 4:101128592-101128614 GAGGGCAAGCAGAAGCAGGGCGG + Intronic
978257229 4:106707377-106707399 GAGTATGGGAAGAAACAGGAAGG + Intergenic
978493979 4:109339752-109339774 GAGGGTGGGCCGAAGCAGGGTGG + Intergenic
978726795 4:111978138-111978160 GAGTAGAGGAAGAAGCAGAAAGG - Intergenic
978906712 4:114013466-114013488 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
979046532 4:115873356-115873378 GATGATATGCAGGACCAGGAAGG + Intergenic
979254829 4:118599013-118599035 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
979334132 4:119447005-119447027 GAGGAGAGGCAGGGGAAGGAGGG + Intergenic
979421310 4:120508953-120508975 GAGGGAAAGCAGAAGCAGGGTGG + Intergenic
979469281 4:121074753-121074775 GAGGGTAGACAGGAGCTGGAAGG + Intergenic
979687252 4:123524506-123524528 GAGGAAAGGAAGAAAGAGGAAGG - Intergenic
980494243 4:133570584-133570606 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
980769254 4:137350722-137350744 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
980888224 4:138786034-138786056 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
980917058 4:139043391-139043413 GTGGATGTGCAGAAGCAGAAAGG - Intronic
981131502 4:141162651-141162673 GAGGACAAGCAGAAGCAGGGTGG + Intronic
981689414 4:147490399-147490421 GAAGATTGACAAAAGCAGGAAGG + Intronic
981795031 4:148585892-148585914 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
981925717 4:150137311-150137333 TGGTAAAGGCAGAAGCAGGAGGG + Intronic
982109810 4:152043859-152043881 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
982794622 4:159630013-159630035 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
982815468 4:159878220-159878242 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
982915498 4:161203793-161203815 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
983046685 4:162995630-162995652 GAGGACAGAGAGTAGCAGGAGGG + Intergenic
983047563 4:163005016-163005038 GAGGGCAAGCCGAAGCAGGATGG - Intergenic
983698259 4:170559503-170559525 GAGGAGAAGCAGGAGCAGGCAGG - Intergenic
983840777 4:172455059-172455081 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
984496018 4:180497951-180497973 GAGGAAAGTCAGAAAAAGGATGG - Intergenic
984526142 4:180861031-180861053 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
984694801 4:182768877-182768899 GGGGTCAGGCAGGAGCAGGAAGG + Intronic
984702230 4:182825777-182825799 GGGGAAAGGGAGAAGGAGGAGGG - Intergenic
984944113 4:184957872-184957894 GAGGATCTGGAGAAGCAAGAAGG + Intergenic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985540720 5:486227-486249 GAGGATGGGCAGGGGCAGCACGG + Intronic
985835675 5:2270229-2270251 GAGGGCAGGCAGAGGCAGGGTGG + Intergenic
986037606 5:3955058-3955080 AAGAATAGGAAGAAGAAGGAAGG - Intergenic
986358458 5:6951964-6951986 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
986443073 5:7798195-7798217 GAGGGTAGTGAGGAGCAGGAGGG + Intronic
986675110 5:10177546-10177568 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
986848857 5:11786536-11786558 CAGGAAAGGCTGAAGCAAGATGG + Intronic
988618130 5:32794853-32794875 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
988626333 5:32879199-32879221 GAGGATAAGGAGAAATAGGAAGG + Intergenic
988628885 5:32907758-32907780 GAGGATATGGAGAAACAGGAAGG - Intergenic
988719121 5:33858855-33858877 GAAGGCAAGCAGAAGCAGGATGG + Intronic
988970712 5:36465105-36465127 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
989345331 5:40423184-40423206 GAGGATGAGCCGAAGCAGGGCGG - Intergenic
989358114 5:40567359-40567381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
989451878 5:41596466-41596488 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
989522504 5:42418395-42418417 GAGAATAAGCTGAAGCAGGGTGG - Intergenic
990244922 5:53854670-53854692 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
990360963 5:55019741-55019763 GAGGAAAGGTGGAGGCAGGAAGG - Intronic
990406680 5:55498016-55498038 GAAGATAAGCAGAACCAGGAGGG + Intronic
990698533 5:58450298-58450320 GATGATAGGCAGTAGAAGGTTGG - Intergenic
990803426 5:59631592-59631614 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
990837073 5:60034106-60034128 GGAGATAGGAAGAAGCAGGAAGG + Intronic
991599578 5:68339200-68339222 GGGAATTGGCAGAAGCAGGATGG + Intergenic
992077767 5:73206913-73206935 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992120999 5:73592087-73592109 GAGGATAGGGAGATGAAGAAAGG - Intergenic
992287207 5:75247990-75248012 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992383936 5:76265769-76265791 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
992740702 5:79770583-79770605 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
992875388 5:81049480-81049502 GAGTAAAGGGAGAATCAGGAGGG - Intronic
993757712 5:91751497-91751519 GAGGATGAGCCGAAGCAGGGTGG - Intergenic
993891612 5:93482296-93482318 GAGGATGAGCCGAAGCAGGTGGG + Intergenic
994014963 5:94955109-94955131 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
994350230 5:98737357-98737379 GAGCATAAGCTGAAGCAGGGTGG + Intergenic
994418721 5:99506327-99506349 GATGATATGGAAAAGCAGGAAGG - Intergenic
994578583 5:101611274-101611296 GATGAAAAGCAGAAGCAGCAGGG - Intergenic
994869685 5:105331629-105331651 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
994942302 5:106340331-106340353 GAGAAACGGCAGAGGCAGGAAGG + Intergenic
995238435 5:109857688-109857710 GAAAATAGTCAAAAGCAGGAAGG - Intronic
995263860 5:110136247-110136269 GAGGGTGAGCAGAAGCAGGCTGG - Intergenic
995464339 5:112435843-112435865 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
996118211 5:119642547-119642569 GAGGAGAGGCAGAAGGATGGAGG - Intergenic
996426701 5:123320609-123320631 GAGGATGAGCAGAAGAAGGGTGG - Intergenic
996428000 5:123335642-123335664 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
996910963 5:128656268-128656290 GAGGGGGAGCAGAAGCAGGATGG - Intronic
997520518 5:134521207-134521229 GAGGCAAAGCTGAAGCAGGAAGG - Intergenic
997596222 5:135109025-135109047 GAGGATAGGCTGGAGAAGGAAGG + Intronic
997628413 5:135347492-135347514 CAGGACAGGTAGAGGCAGGAGGG - Intronic
997809608 5:136954339-136954361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
998407579 5:141882816-141882838 GAGGGGAGACAGGAGCAGGAAGG + Intergenic
999439592 5:151591129-151591151 GAGGATGGGAAGATGCGGGAGGG - Intergenic
999502466 5:152160601-152160623 GAGGGCAGGCAGAAGCCGGGTGG - Intergenic
1000010112 5:157223132-157223154 GAGCAGAGGCAGAAGGAAGAGGG + Intronic
1000194858 5:158947487-158947509 GAGGGCGAGCAGAAGCAGGACGG - Intronic
1000574791 5:162964661-162964683 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1001116493 5:168945006-168945028 GAGGAAAGGAAGAGGAAGGAGGG + Intronic
1001418997 5:171572670-171572692 GAAAGTAGGGAGAAGCAGGAGGG - Intergenic
1001884533 5:175277525-175277547 AAGGATTGGCAGAAGAAGGCAGG - Intergenic
1002017917 5:176340556-176340578 GGGGAAAAGCAGAAGCAGGTAGG + Intronic
1002352440 5:178592412-178592434 GAGCAGAGGCAGAAGGAAGAAGG + Intergenic
1002376545 5:178793262-178793284 AGGGATAGGCAGCACCAGGAAGG - Intergenic
1002554726 5:180027387-180027409 GAGTATAAGCAGAAACAGAAAGG + Intronic
1002685697 5:181007882-181007904 GAAGGCAGGCAGAAGCAGGGCGG + Intergenic
1002725019 5:181289079-181289101 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1003245459 6:4378569-4378591 GGGGATAGACACTAGCAGGAAGG - Intergenic
1003455288 6:6276238-6276260 GAGGATTGGAAGCAGGAGGAGGG + Intronic
1003788122 6:9510884-9510906 GAGAATTGCCAGAACCAGGAAGG - Intergenic
1005027568 6:21478111-21478133 GAGGGGAGGCTGAAGAAGGATGG - Intergenic
1005081924 6:21965306-21965328 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081929 6:21965321-21965343 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081934 6:21965336-21965358 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081939 6:21965351-21965373 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081944 6:21965366-21965388 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081949 6:21965381-21965403 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005125480 6:22442220-22442242 GAAAAAAAGCAGAAGCAGGAAGG + Intergenic
1005806853 6:29481477-29481499 GAGGATGTGGAGAAACAGGAAGG - Intergenic
1006313944 6:33279432-33279454 GGGCAGAGGCACAAGCAGGAGGG + Intronic
1006789698 6:36691838-36691860 CAGAAATGGCAGAAGCAGGATGG - Intergenic
1006906113 6:37534870-37534892 CAGGATAAGGAGAAGCAGAAAGG - Intergenic
1008037889 6:46765234-46765256 TAGGATTTGGAGAAGCAGGAGGG - Intergenic
1009212892 6:60884219-60884241 GAGGATATGGAGAAATAGGAAGG - Intergenic
1009264031 6:61531638-61531660 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
1009455181 6:63848530-63848552 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
1009458670 6:63887502-63887524 GAGGGTGGGCAGAATCAGGGAGG + Intronic
1009562368 6:65263791-65263813 CTTGATAGGCAGAGGCAGGACGG + Intronic
1009676304 6:66826830-66826852 GTGAATAAGCAGAAGCAGCAGGG - Intergenic
1009815987 6:68736118-68736140 CAGGAGAGGCTGAAGCAGGAGGG - Intronic
1010574870 6:77518357-77518379 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1010780021 6:79934498-79934520 GAGAATAGGCTGCAGCAGAAGGG - Intronic
1011235656 6:85213452-85213474 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1011831315 6:91374987-91375009 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1011980850 6:93376004-93376026 GAAGATAGTCAGAAGGAGGTGGG + Intronic
1012083159 6:94785735-94785757 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1012092814 6:94920229-94920251 GAGGAGAGGAAGAAACATGATGG - Intergenic
1012258378 6:97060381-97060403 GAGGATGAGCTGAAGAAGGAGGG + Intronic
1012429806 6:99152702-99152724 TAGGATAGGAAGAGACAGGAAGG + Intergenic
1012646189 6:101684983-101685005 GAGAAGACACAGAAGCAGGAAGG - Intronic
1013342839 6:109232105-109232127 GAGGAGTGGCAGAAGGAAGAGGG - Intergenic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013474502 6:110495030-110495052 GAGAATTGGAAGCAGCAGGATGG - Intergenic
1013682506 6:112541095-112541117 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1013920239 6:115394892-115394914 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1014315067 6:119853778-119853800 TAAGATATGCGGAAGCAGGAGGG + Intergenic
1014527905 6:122522706-122522728 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1014747865 6:125221005-125221027 GTGGAGAGGCCAAAGCAGGAAGG - Intronic
1015027495 6:128554069-128554091 GAAGAGAGGGAGAAGGAGGATGG - Intergenic
1015382295 6:132583339-132583361 CAGAATAGGCAGAGGCAGCATGG + Intergenic
1015471788 6:133614456-133614478 GAGGGTGGGCCGAAGCAGGGTGG + Intergenic
1015697277 6:135995039-135995061 GGGGACATGAAGAAGCAGGATGG - Intronic
1015832422 6:137384868-137384890 GAGGAGAGAGAGAAGCAGAATGG + Intergenic
1016014368 6:139168571-139168593 CAGGACAGGTAGAAGCAGGAGGG - Intronic
1016593050 6:145766940-145766962 GAGGGCAGGCCGAAGCAGGGTGG - Intergenic
1016730808 6:147425567-147425589 GAGGATGTGGAGAAGTAGGAAGG - Intergenic
1017357039 6:153521464-153521486 GAGGGTGAGCTGAAGCAGGAGGG - Intergenic
1017858417 6:158372309-158372331 GAGGATCTGGAGAAGAAGGAAGG - Intronic
1018108628 6:160513532-160513554 GAGGGTTAGCAGAAGCAGGCTGG + Intergenic
1018494314 6:164333273-164333295 GAGGATAAGCACAAGCAACAAGG + Intergenic
1018507907 6:164491237-164491259 GAGGCCAGGCAGCAGCAGGGTGG - Intergenic
1018952656 6:168389232-168389254 GAGGGCAGGCAGAGGCATGAAGG - Intergenic
1018979553 6:168592191-168592213 GAAGATTGAGAGAAGCAGGATGG - Intronic
1019013341 6:168860923-168860945 GAGGAGAGGGAGAAAGAGGAAGG + Intergenic
1019020394 6:168913080-168913102 TTGGATAGGCAGGAACAGGAGGG - Intergenic
1019517529 7:1446466-1446488 GAGGATAGAGAGGAGAAGGAAGG + Intronic
1019531685 7:1506557-1506579 GAGGAGGGGGAGAAGAAGGAAGG - Intergenic
1019603353 7:1896149-1896171 GAGGTCAGGGAGAGGCAGGAAGG - Intronic
1019797636 7:3063525-3063547 GAGGAGAAGCAGAAGAAAGAAGG - Intergenic
1019985467 7:4652263-4652285 GAGGAAAGGAATGAGCAGGAGGG - Intergenic
1020011514 7:4808087-4808109 GAAGAGAGGAAGAAGGAGGAGGG - Intronic
1020339071 7:7089572-7089594 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1020715974 7:11675113-11675135 GAGGGCAAGCAGAAGCAGGTGGG + Intronic
1020823930 7:13003261-13003283 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1021014579 7:15517511-15517533 GAGGCCAAGCAGAAGCAGGGTGG + Intronic
1021347751 7:19548540-19548562 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1021574426 7:22094273-22094295 GAGGGAAGGCAGTGGCAGGAGGG + Intergenic
1021616151 7:22505100-22505122 GAGAAGAGGAAGAAGGAGGAAGG + Intronic
1022058930 7:26770750-26770772 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1022174365 7:27859236-27859258 GAGGATGTGGAGAAACAGGAAGG + Intronic
1022208746 7:28187747-28187769 GAGGATACTGAGAATCAGGATGG + Intergenic
1022251555 7:28613421-28613443 GAGGATAGGCTCAAGCCGGGTGG - Intronic
1022842847 7:34181171-34181193 GATAATAGGCAGAGGCAGGAAGG + Intergenic
1022925942 7:35056316-35056338 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1023099072 7:36694885-36694907 GAGGATAGACAGATGATGGATGG + Intronic
1023135462 7:37047292-37047314 AAGGAAAGGCAGAGACAGGAAGG - Intronic
1023456874 7:40349056-40349078 GAGGATATACAGAAGGAGGGTGG - Intronic
1023511707 7:40959969-40959991 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1023522901 7:41066652-41066674 GAGGATAGACAGAGGAATGATGG - Intergenic
1023710443 7:42986896-42986918 CAGGATAGGAAGAAAGAGGAAGG + Intergenic
1023718261 7:43066099-43066121 GAGGATAGGCTGAGGCCAGAAGG + Intergenic
1023842630 7:44105666-44105688 AAGGAGAGCCAGAGGCAGGAGGG - Intronic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1023894230 7:44418771-44418793 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1023943464 7:44785151-44785173 GAGGTGAGGATGAAGCAGGAGGG - Intergenic
1024017643 7:45332692-45332714 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1024054335 7:45649987-45650009 GATGCTGGGCAGAAGCAGGAAGG + Intronic
1024069920 7:45776692-45776714 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1024359688 7:48455154-48455176 GAGGACTGGCAGCAGCAGGTCGG - Exonic
1024586171 7:50843925-50843947 GAGCATGGTCAGAAGCAAGAAGG + Intergenic
1024664993 7:51537073-51537095 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1025055781 7:55763862-55763884 GAGGAAAGGCAGAAACAGACAGG - Intergenic
1025187379 7:56871520-56871542 GAGGAGAGGCTGGGGCAGGAGGG + Intergenic
1025188792 7:56881324-56881346 GAGGAGAGGCCGGGGCAGGAGGG + Intergenic
1025608829 7:63058968-63058990 GAGGAAAGGCAGAAACAGACAGG - Intergenic
1025683143 7:63695596-63695618 GAGGAGAGGCTGGGGCAGGAGGG - Intergenic
1025684546 7:63705400-63705422 GAGGAGAGGCTGGGGCAGGAGGG - Intergenic
1026038352 7:66845837-66845859 GAGGAGACGCAGGGGCAGGAAGG - Intergenic
1026191892 7:68136436-68136458 GAGGAGAAGGAGAAGAAGGAAGG + Intergenic
1026398309 7:69982441-69982463 CAGGATAGCCTGGAGCAGGAGGG - Intronic
1026678351 7:72446940-72446962 GAGGAAAAGCAGAAGGGGGAAGG + Intronic
1026792856 7:73346102-73346124 GAGGAAAGGAAGTAGCAGGAGGG + Intronic
1027213054 7:76165752-76165774 GAGGAGACGCAGGGGCAGGAAGG + Intergenic
1027689811 7:81330317-81330339 TATGAGAGCCAGAAGCAGGAAGG + Intergenic
1028078779 7:86548247-86548269 GAGGATGAGCTGAAGCAGGATGG - Intergenic
1028376320 7:90149235-90149257 GAGAAGAGGAAGAAGGAGGAAGG - Intergenic
1028596658 7:92553318-92553340 GAGGATAGGCTGATGGTGGAGGG + Intergenic
1029823948 7:103171006-103171028 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1029935818 7:104423164-104423186 TAGGATGGGCAGAGGCAGCAGGG + Intronic
1030482225 7:110119552-110119574 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1030524356 7:110635690-110635712 GTGGATAGACAGTACCAGGAAGG + Intergenic
1030663557 7:112249227-112249249 CAGGATGGGCTGAGGCAGGAGGG + Intronic
1031613852 7:123857477-123857499 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1032047318 7:128620978-128621000 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1032419142 7:131764126-131764148 GGGAACAGGCAGAAGTAGGAGGG - Intergenic
1032421465 7:131783135-131783157 GGGGCTTGGGAGAAGCAGGAAGG + Intergenic
1032432760 7:131875358-131875380 GAGGTTAAGCATAAGGAGGAAGG - Intergenic
1032644642 7:133809329-133809351 GAGGATTGGCACAATGAGGATGG + Intronic
1032659834 7:133970640-133970662 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1032893225 7:136222315-136222337 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1032957201 7:136984741-136984763 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1033234243 7:139625607-139625629 GAGGATGGGCATGAGCAGGCAGG - Intronic
1033586702 7:142779674-142779696 GAGGAGAGGAAGCAGAAGGAGGG - Intergenic
1034314402 7:150116928-150116950 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1034512287 7:151545781-151545803 GAGGATGGGAAGGTGCAGGAGGG + Intergenic
1034792493 7:153983841-153983863 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1035568750 8:658878-658900 AAGGAAAGGCAGAGGAAGGACGG - Intronic
1035793982 8:2336757-2336779 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1035798823 8:2384951-2384973 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1035825334 8:2639086-2639108 GAGGCCAGGCAGAAGCTGCAAGG - Intergenic
1035998403 8:4574419-4574441 GAGGGTAAGCAGAAGAAGGGTGG - Intronic
1036916644 8:12810722-12810744 GAGCAAAGGGAGAAGAAGGAAGG - Intergenic
1037285559 8:17294725-17294747 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1037338586 8:17816467-17816489 GAGGATATGGAGAAATAGGAAGG + Intergenic
1037626059 8:20607932-20607954 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
1037856404 8:22374351-22374373 GTGGAAAGTCAGATGCAGGATGG + Intronic
1037881379 8:22575039-22575061 GAGGAAACGCTGGAGCAGGATGG - Exonic
1039768377 8:40656264-40656286 TAGGATAGGCAGAATAAAGAAGG + Intronic
1040846255 8:51844646-51844668 GAGGAAGGGCAAAGGCAGGAGGG + Intronic
1040968890 8:53112787-53112809 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1041154969 8:54976733-54976755 GAGGACAAGCAGAAGCAGGGAGG + Intergenic
1041419160 8:57647278-57647300 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1041630658 8:60083230-60083252 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1041679741 8:60576766-60576788 GAGGAAAGGCAGAAGTGGGGAGG - Intronic
1041900718 8:62979009-62979031 GAGGGCAAGCAGAAGCAGGGTGG - Exonic
1041924904 8:63226766-63226788 TGGGATAGGTAGAAGCTGGAAGG + Intergenic
1041967202 8:63692719-63692741 CACGATAGTCAGAAGCAGGATGG - Intergenic
1042478731 8:69280045-69280067 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1042525573 8:69761443-69761465 AAGGAAAGACGGAAGCAGGAGGG - Intronic
1042627244 8:70771208-70771230 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1042969386 8:74391475-74391497 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1043036749 8:75208635-75208657 GAAGGTGAGCAGAAGCAGGATGG - Intergenic
1043253749 8:78106872-78106894 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1043605180 8:81991078-81991100 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
1043795609 8:84534706-84534728 GAGAACAGGGAGAAGAAGGAAGG + Intronic
1044509559 8:93058759-93058781 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044595354 8:93953565-93953587 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1044940346 8:97335434-97335456 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1045185265 8:99830895-99830917 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1045199581 8:99967069-99967091 GAGCATGAGCAGAAGCAGGGTGG + Intronic
1045390499 8:101710120-101710142 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1045733578 8:105268560-105268582 TAGGACAGGCAGGAGCAAGATGG - Intronic
1045747485 8:105440678-105440700 GAGAAGATGCAGGAGCAGGAGGG + Intronic
1045839269 8:106560855-106560877 GAGGATGAGCAAAAGCAGGATGG + Intronic
1045856326 8:106769568-106769590 GAGGAGAGGCCCGAGCAGGATGG - Exonic
1046014550 8:108589901-108589923 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1046153560 8:110258200-110258222 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1046696107 8:117341282-117341304 GAGGCTAGGAGGAAGGAGGAGGG + Intergenic
1046890516 8:119416588-119416610 CAGGAGATGGAGAAGCAGGAAGG - Exonic
1047435376 8:124831456-124831478 GAGGATGAGAAGAAGCAGAAAGG - Intergenic
1047690888 8:127353439-127353461 AAGGAAAGGAAGACGCAGGAAGG + Intergenic
1048007582 8:130431856-130431878 GAGGAAAGGGAGGAGTAGGAGGG + Intronic
1048254096 8:132892252-132892274 AAGGATAGGCAGATGATGGATGG - Intronic
1048473190 8:134721340-134721362 GAGGCTAGGCAGAGGCTGGCAGG - Intergenic
1048599345 8:135902494-135902516 GAAGCTAGGAAGACGCAGGAAGG - Intergenic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1051121192 9:13754070-13754092 GAGGAGAGGGAGGAGCAGAAAGG + Intergenic
1051452057 9:17207635-17207657 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1051695895 9:19767597-19767619 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1052144127 9:25026158-25026180 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1052236456 9:26216978-26217000 GAGCATAGGAAGAAGCAGGAGGG - Intergenic
1052323753 9:27195246-27195268 GAGGGTAGTCAGAACCAGGCTGG + Intronic
1052329287 9:27251328-27251350 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
1052336764 9:27328219-27328241 CAGGTTAGGAAGAAGAAGGAGGG + Exonic
1052343581 9:27386054-27386076 AAGGAAAAGCAGCAGCAGGATGG - Intronic
1053096552 9:35333545-35333567 GATGAAAGGGAGAAGGAGGAAGG - Intronic
1053169711 9:35869772-35869794 GGGTACAGGCAGCAGCAGGATGG + Exonic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053415634 9:37945327-37945349 CAGGATATGCAGTACCAGGACGG + Intronic
1053800345 9:41760068-41760090 GAGGCCAGGCAGAAGCAGCATGG + Intergenic
1054144853 9:61554767-61554789 GAGGCCAGGCAGAAGCAGCATGG - Intergenic
1054188772 9:61972220-61972242 GAGGCCAGGCAGAAGCAGCATGG + Intergenic
1054377575 9:64461074-64461096 GAGGATAGGGGGTAGTAGGAAGG + Intergenic
1054464545 9:65485724-65485746 GAGGCCAGGCAGAAGCAGCATGG - Intergenic
1054649749 9:67616397-67616419 GAGGCCAGGCAGAAGCAGCATGG - Intergenic
1055339053 9:75262234-75262256 GAAGGTGAGCAGAAGCAGGATGG - Intergenic
1055345124 9:75327443-75327465 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1055628676 9:78200799-78200821 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1055823970 9:80301562-80301584 GAGGGCGAGCAGAAGCAGGATGG - Intergenic
1056385227 9:86091052-86091074 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1056417386 9:86390112-86390134 GAGGATTAGCTGAAGCAGGGTGG + Intergenic
1058265712 9:102897255-102897277 GAGGGTGAGCAGAAGCAGGGAGG + Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1059505919 9:114799841-114799863 GAGGAAGTGCAGAGGCAGGAAGG - Intronic
1060035275 9:120250205-120250227 GAGGGTACGTAGAAGGAGGATGG - Intergenic
1060187359 9:121571869-121571891 CAGGACAGTCAGAGGCAGGAAGG + Intronic
1061045520 9:128162975-128162997 GAGGAAAGGAAGAGGCAGGGAGG + Intronic
1061255251 9:129451444-129451466 GAGGAGAGGCAGGAGCTGGGAGG - Intergenic
1061656790 9:132098047-132098069 GAGGAAAGGGAGAAGGTGGATGG + Intergenic
1061811965 9:133167417-133167439 GGGGGTGGGCAGCAGCAGGAGGG + Intergenic
1062144046 9:134979062-134979084 GAGGAAAGAGAGAAGGAGGAAGG + Intergenic
1062398599 9:136362723-136362745 GAGGGCAGGCAGAGGCAGGGAGG + Intronic
1062750163 9:138246726-138246748 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1203780101 EBV:96257-96279 GAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780114 EBV:96290-96312 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780133 EBV:96341-96363 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780138 EBV:96356-96378 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780143 EBV:96371-96393 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780148 EBV:96386-96408 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780157 EBV:96410-96432 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780166 EBV:96434-96456 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780195 EBV:96512-96534 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780204 EBV:96536-96558 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780213 EBV:96560-96582 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780228 EBV:96602-96624 GAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1186333132 X:8557687-8557709 GAGGATATGGAGAAATAGGAAGG + Intronic
1186479281 X:9883748-9883770 GAGGATTGGCAGGAAAAGGAAGG + Intronic
1186773393 X:12839656-12839678 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1186832432 X:13404141-13404163 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1186927547 X:14351889-14351911 GTGGAAATGCAGAAGCAGGAGGG + Intergenic
1187144067 X:16621495-16621517 GAGCATGTGGAGAAGCAGGATGG + Intronic
1187155141 X:16714680-16714702 CAGGGGAGGCTGAAGCAGGAAGG + Intergenic
1187248408 X:17574671-17574693 GAGGGTGAGCCGAAGCAGGATGG - Intronic
1187649559 X:21387390-21387412 GAGGATCACCAGAACCAGGAAGG + Intronic
1187660759 X:21544734-21544756 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1187951552 X:24475703-24475725 GAGGAAAGGTAGAAGACGGAAGG + Intronic
1188193129 X:27196830-27196852 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1188864717 X:35300555-35300577 GAACATAGGCAGTAGCAAGATGG + Intergenic
1188915539 X:35905161-35905183 GAGAGTGAGCAGAAGCAGGATGG - Intergenic
1188924671 X:36024326-36024348 GAAGAGAGGCAAAAGCAGGAAGG - Intergenic
1189097932 X:38159821-38159843 GAGGATAGGCAGGGGCAAGATGG + Intronic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1190113211 X:47608619-47608641 GAGGAGAGGGAGCAACAGGAGGG + Intronic
1190288861 X:48978553-48978575 GGGGAAAGGCAGAAGCAGACAGG + Intronic
1190727769 X:53201811-53201833 GATGGTGGGGAGAAGCAGGAGGG - Intronic
1190963805 X:55278395-55278417 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191003836 X:55689100-55689122 GAGGGTAAGCCGAAGCAGGGTGG - Intergenic
1191004996 X:55702268-55702290 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191024202 X:55896238-55896260 GAGGACGAGCAGAAGCAGGGTGG + Intergenic
1191094428 X:56659427-56659449 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1191119660 X:56890468-56890490 GAGTGTAAGCAGAAGCAGGATGG + Intergenic
1191135488 X:57059245-57059267 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1191148181 X:57190691-57190713 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1191174241 X:57482534-57482556 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191227367 X:58057847-58057869 GAAGATAGGGAGTAGAAGGATGG - Intergenic
1191591253 X:62887957-62887979 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191606165 X:63065475-63065497 GAGGGGAAGCAGAAGCAGGGTGG + Intergenic
1191650220 X:63529232-63529254 GAGGAGAGGCATGAGTAGGAAGG + Intergenic
1191657374 X:63613313-63613335 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1191676556 X:63797624-63797646 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191802632 X:65098592-65098614 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1191809865 X:65175174-65175196 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1191987306 X:66995435-66995457 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192569343 X:72190041-72190063 CAGGATTGGCGGAGGCAGGAAGG - Intronic
1192740943 X:73892376-73892398 GAGTATGAGCCGAAGCAGGATGG + Intergenic
1192759273 X:74078346-74078368 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1192980292 X:76332183-76332205 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1193019981 X:76781082-76781104 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193160584 X:78224607-78224629 GAGGATGGAGAGTAGCAGGAGGG + Intergenic
1193228498 X:79013712-79013734 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1193254102 X:79325977-79325999 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1193341384 X:80352970-80352992 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1193398182 X:81010527-81010549 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193404398 X:81083781-81083803 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1193514314 X:82445443-82445465 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1193571597 X:83151536-83151558 GAGGACGAGCAGAAGCAGGGTGG + Intergenic
1193897181 X:87128461-87128483 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1194050199 X:89058646-89058668 GAGGAAAGGGAGAAGAAGAAAGG - Intergenic
1194203193 X:90979359-90979381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194315371 X:92369793-92369815 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1194394685 X:93367637-93367659 GAAGATAGACAGTAGAAGGATGG - Intergenic
1194501574 X:94688119-94688141 GAGAATTGGCAGAAGCATCAGGG + Intergenic
1194631539 X:96291548-96291570 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1194643487 X:96429882-96429904 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1195140021 X:101950016-101950038 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1195435996 X:104843688-104843710 GAGAGCAAGCAGAAGCAGGATGG - Intronic
1195810708 X:108825504-108825526 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1195820952 X:108944660-108944682 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1196133315 X:112181025-112181047 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1196286543 X:113887750-113887772 GAGTATAGACAGTAGAAGGATGG - Intergenic
1196289578 X:113923225-113923247 GAGTAAAGGGAGATGCAGGAGGG + Intergenic
1196603049 X:117623388-117623410 GAGGGTCAGCAGAAGCAGGGTGG - Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197316116 X:124967830-124967852 GAGGATGGGTTGGAGCAGGAAGG - Intergenic
1197551194 X:127894744-127894766 GAGCAAAGGCAGAAGCAAGGAGG - Intergenic
1197614400 X:128675351-128675373 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1198572194 X:137969951-137969973 GATGATAGGGAGAAGGAAGAGGG - Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1198944624 X:141996603-141996625 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1199451358 X:147981778-147981800 GAGGACAGGAAGGGGCAGGAAGG - Intronic
1199473882 X:148224750-148224772 GTGGATGGGCAGAAGCTGCATGG + Intergenic
1200227976 X:154429723-154429745 GAGGATTGGCAGACTCAGGCTGG - Intronic
1200337944 X:155369833-155369855 GAGGAGAAGCAGGAGAAGGAGGG + Intergenic
1200348526 X:155471393-155471415 GAGGAGAAGCAGGAGAAGGAGGG - Intergenic
1200405949 Y:2811580-2811602 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
1200416075 Y:2911449-2911471 GAGGATAGGCAGAAACAAAGAGG + Intronic
1200549026 Y:4554785-4554807 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1200623420 Y:5481328-5481350 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1200664047 Y:5998794-5998816 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201543145 Y:15131532-15131554 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1201741493 Y:17328598-17328620 GGTGATAGGCAGAGGTAGGATGG + Intergenic
1201922123 Y:19245213-19245235 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic