ID: 1067843837

View in Genome Browser
Species Human (GRCh38)
Location 10:49702837-49702859
Sequence TAGTAGAGGTAGTTGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067843837_1067843843 5 Left 1067843837 10:49702837-49702859 CCTGACTCCAACTACCTCTACTA 0: 1
1: 0
2: 1
3: 8
4: 123
Right 1067843843 10:49702865-49702887 CATCTAAGCATGGAGTGTTCTGG No data
1067843837_1067843840 -5 Left 1067843837 10:49702837-49702859 CCTGACTCCAACTACCTCTACTA 0: 1
1: 0
2: 1
3: 8
4: 123
Right 1067843840 10:49702855-49702877 TACTAACCACCATCTAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067843837 Original CRISPR TAGTAGAGGTAGTTGGAGTC AGG (reversed) Intronic
900853610 1:5163159-5163181 TTGTTGAGGTGGTTGGAGGCTGG - Intergenic
903807934 1:26018692-26018714 GAATAGAAGTAGTTGGATTCTGG - Intergenic
904089603 1:27935498-27935520 TAGTAGAGGTAGGAGGTGGCAGG + Intronic
904967178 1:34384251-34384273 TGCTATAGGGAGTTGGAGTCGGG - Intergenic
905710165 1:40095443-40095465 TTGTAGAGGCATTTGGAGTGTGG - Intronic
918124702 1:181572821-181572843 TAGGAGAGGTGCATGGAGTCTGG + Intronic
920854344 1:209651215-209651237 TAGAGGAGGAAGCTGGAGTCTGG - Exonic
1063453644 10:6168176-6168198 GACTAGAGGTAGTGGGAGGCTGG + Intronic
1067843837 10:49702837-49702859 TAGTAGAGGTAGTTGGAGTCAGG - Intronic
1068832148 10:61507589-61507611 CAGAAGAGGTAGTGGGAGGCAGG + Intergenic
1070444573 10:76483628-76483650 TAGTAGAAATAGTTGAAGTGTGG + Intronic
1073047907 10:100651377-100651399 TAGTGGAGGTGGTGGGAGTGGGG - Intergenic
1073047919 10:100651413-100651435 TAGTGGAGGTGGTGGGAGTGGGG - Intergenic
1073144697 10:101272792-101272814 TAGTAGAGGTTGGTGGAGGCCGG + Intergenic
1077436318 11:2540895-2540917 TGGTCAAGGTAGTTGAAGTCGGG + Intronic
1081639976 11:44746354-44746376 TAGTAAATTTAGGTGGAGTCAGG - Intronic
1085712847 11:78845515-78845537 TAGTTGAGGTTGTTGGAGGCAGG - Intronic
1086499715 11:87439789-87439811 TGGGAGAGGTAGTTGGCTTCAGG + Intergenic
1092783586 12:12008745-12008767 TACCAGAGGGAGCTGGAGTCAGG - Intergenic
1097071083 12:56355418-56355440 TAGTAGATGTGGTAGGAGTTAGG - Intronic
1097295193 12:57955420-57955442 AAGTGGAGGTAGTAGGAATCTGG + Intronic
1099367423 12:81785289-81785311 AAGTTGAGGTGGATGGAGTCCGG - Intergenic
1099588760 12:84557291-84557313 TAGTATAGGAAGTTTGAATCTGG + Intergenic
1099822184 12:87726441-87726463 TGGTAGAGGTAGTAGTAGTAAGG - Intergenic
1101745925 12:107541559-107541581 TAGTAAAAGTTGTTGCAGTCTGG + Intronic
1104359789 12:128121745-128121767 TAGGGGAAGTAGCTGGAGTCTGG - Intergenic
1115560401 14:34577693-34577715 TAGTATAGCTTGTTTGAGTCAGG - Intronic
1116883609 14:50196560-50196582 TAGGAAAGGTAGCTGGAGTGGGG - Intronic
1118107245 14:62673861-62673883 CAGTAGGGGCAGTGGGAGTCAGG - Intergenic
1123409637 15:20047978-20048000 TAGCCGAGGTAGTAGCAGTCTGG + Intergenic
1123518968 15:21054686-21054708 TAGCCGAGGTAGTAGCAGTCTGG + Intergenic
1124125601 15:26936001-26936023 TAGTAGAGGTAATTGGATTATGG + Intronic
1125350189 15:38758517-38758539 TAGCAGAGGGATTTGGACTCGGG + Intergenic
1126829688 15:52588618-52588640 TAGTAGAGATGGTTGGGGGCAGG + Intronic
1127976362 15:64000162-64000184 TAGTAGTAGTAGTAGTAGTCAGG - Intronic
1130043939 15:80429768-80429790 TAGGAGATGCAGTTGGTGTCTGG + Intronic
1133078346 16:3296894-3296916 TCGCAGAGGGAGTTGGTGTCTGG + Intronic
1138282274 16:55780989-55781011 TGGGAGGAGTAGTTGGAGTCTGG + Intergenic
1138286673 16:55815651-55815673 TGGGAGGAGTAGTTGGAGTCTGG - Intronic
1144071075 17:11671607-11671629 TAGAGGAGGTGGTTGGACTCTGG + Intronic
1145118764 17:20236632-20236654 TAGTACAGGCATTTGCAGTCTGG + Intronic
1149278355 17:55071370-55071392 TAGTAGAGGTAGGAGTAGTAGGG - Intronic
1153390494 18:4552331-4552353 TAGTAGAGGTAGTAGGATGGTGG + Intergenic
1153805853 18:8707283-8707305 CAGTAGAGGTCCTTGGAGTGTGG + Intronic
1153809137 18:8736544-8736566 TTGTACAGGTATTTGAAGTCGGG + Intronic
1155342378 18:24825886-24825908 TAGCCGAGGAAGTTAGAGTCAGG + Intergenic
1157332554 18:46714316-46714338 AAGAAAAGGGAGTTGGAGTCGGG - Intronic
1158317193 18:56224422-56224444 TAGAAGAGATAATTGGAATCAGG - Intergenic
1158941922 18:62412496-62412518 TAGAAGAGGGAGGTGGAGGCTGG - Intergenic
1159174949 18:64820435-64820457 TTGTAGAGGAAGCTGTAGTCAGG - Intergenic
1161333347 19:3698650-3698672 TGGCAGAGGTATTTTGAGTCAGG - Intronic
1161519199 19:4714086-4714108 TAGTAGAGGCGGTGGGAGTGGGG + Exonic
1164421306 19:28095592-28095614 TAGTAGATATACTTGGAGACAGG + Intergenic
1167062813 19:47160939-47160961 TAGGAGAGTTAGTTGGGGTGGGG + Intronic
1167844279 19:52147983-52148005 TAGCAGAGGGAATTGGAGTTTGG + Intergenic
925209394 2:2033673-2033695 TAATAGAGGTGGGTGGAGTAGGG + Intronic
925907349 2:8547403-8547425 CAGTAGAGGCCGCTGGAGTCGGG - Intergenic
927490048 2:23515290-23515312 GAGTAGAGGTTGTGGGAGTGGGG - Intronic
928217456 2:29373826-29373848 CTGTAGAGGTAGTTGGAGGCAGG - Intronic
929418227 2:41765698-41765720 GGATAGAGGTAGCTGGAGTCAGG + Intergenic
929551769 2:42897830-42897852 TTCTAGAGGTAGTAGGATTCGGG + Intergenic
930261987 2:49157683-49157705 AAGAAAAGGAAGTTGGAGTCAGG - Intergenic
930296323 2:49558917-49558939 TTCTAGAGGTAGTTGGGGTTGGG + Intergenic
930809255 2:55523493-55523515 TAATAGAAATAGTTGAAGTCAGG - Intronic
931060793 2:58527197-58527219 TAGTAGAGATAGTAGGATTGAGG + Intergenic
932386268 2:71335871-71335893 TGGTAAAGGTTGTTGGAGTCAGG + Intronic
940435179 2:153644635-153644657 GGGTAGAGGTAGGTGGAGGCTGG - Intergenic
942987748 2:182162760-182162782 TAGTAGAGGTTAGGGGAGTCAGG + Intronic
944763419 2:202840569-202840591 GAGGAGAGCCAGTTGGAGTCTGG - Intronic
946865997 2:224041156-224041178 TAATAGAGGTAATTGTAGGCTGG + Intergenic
948229762 2:236341442-236341464 GAGTGGAGGTACTTGGAGTTTGG + Intronic
948810999 2:240478409-240478431 TAGCAGAGGTAGTGGAAGCCGGG + Intergenic
1173172852 20:40741583-40741605 GAGTGGAGGTGGTTGGGGTCAGG - Intergenic
1175593712 20:60213694-60213716 TGGCAGAGGTAGTTGGGGGCAGG - Intergenic
1183075416 22:35423569-35423591 GAGCAGAGGTGGTTGGATTCTGG + Intronic
1183759826 22:39805953-39805975 TAGAAGAGGTGGTTGGAGAAAGG - Intronic
1184801122 22:46760463-46760485 TTCTAGTGGTAGTTGGGGTCTGG - Intergenic
951828032 3:26890207-26890229 TGCTAGAGGTAGTTGGAAACAGG + Intergenic
955411079 3:58655846-58655868 AAGTAGAGGAAGGTGTAGTCTGG + Intronic
955412140 3:58662656-58662678 AAGTAGGGGCAGTTGGAGTTGGG + Intronic
957794491 3:84986378-84986400 TAGTAGTGGGAGATGGAGTGAGG - Intronic
958851185 3:99327516-99327538 TAATACAGGAAGTTGGGGTCTGG + Intergenic
959826726 3:110806005-110806027 CTGTAAAGGTAGTTGGAGTGTGG + Intergenic
960079671 3:113527828-113527850 TAAATGAGGTAGTTGGAGTTGGG - Intergenic
960260308 3:115560368-115560390 TAGTAGATGTAGAATGAGTCTGG - Intergenic
960883925 3:122375174-122375196 AAGGAGAGGTAGTTGGACTTAGG + Intronic
962839883 3:139223770-139223792 TAGTAAATGTGGATGGAGTCAGG + Intronic
964802268 3:160568986-160569008 TAGGAGAGCCAGCTGGAGTCTGG + Intergenic
965572793 3:170188503-170188525 TAGTAAAAGTATTTGGAGTCGGG - Intergenic
973293936 4:48495131-48495153 TACTAGACGCAGTTAGAGTCTGG - Intergenic
977372244 4:96153497-96153519 CAGTAGTGGTATTTGCAGTCTGG - Intergenic
978227285 4:106352546-106352568 TAGTAGAGATTTTTGGTGTCTGG + Intergenic
979576954 4:122304090-122304112 TGGTAGTGGTTGTTGAAGTCTGG - Intronic
980325947 4:131346375-131346397 AAGTAAAGGTAATTGGAATCAGG + Intergenic
981138462 4:141239165-141239187 TAGCAGAGGTAGTAGTTGTCAGG + Intergenic
983811557 4:172068242-172068264 TAGTAGAGGTAGCTTGAGCTAGG - Intronic
991658167 5:68923853-68923875 TAGTAAAGTTAATAGGAGTCTGG + Intergenic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
997880534 5:137585292-137585314 TAGTAGTGGTAGTAGTAGTATGG - Intronic
998978958 5:147679275-147679297 TAGAAAATGTAGTTGGAGGCTGG - Intronic
1003271265 6:4609934-4609956 TATCAGAGGTGGTGGGAGTCAGG + Intergenic
1007016009 6:38467480-38467502 TACTAGAGATAGTTGAACTCAGG + Intronic
1007102899 6:39262127-39262149 GAGCAGAGGTGGATGGAGTCTGG - Intergenic
1007288737 6:40768218-40768240 TTGCAGAGGTAGGTGGTGTCTGG + Intergenic
1008879096 6:56362736-56362758 TGGTAGAGGTGGTGGGAGTGGGG - Intronic
1011885604 6:92091019-92091041 GAGTGGAGGTGGATGGAGTCAGG - Intergenic
1012255063 6:97021986-97022008 TACTAGAAGTGGCTGGAGTCTGG - Intronic
1012657297 6:101840467-101840489 TAGTGGGGTTAATTGGAGTCAGG - Intronic
1013269231 6:108530375-108530397 TAGAAGAGGTATCTGGAATCTGG - Intergenic
1015729056 6:136329706-136329728 TATTGGAGATAATTGGAGTCAGG - Intergenic
1016688555 6:146909137-146909159 AAGTACAGGAAGTTGGAGACTGG + Intergenic
1018381342 6:163260732-163260754 CAGGAGAGGAAGTTGGAGACAGG - Intronic
1021526640 7:21595430-21595452 GATTAGAAGTAGTTGGATTCTGG + Intronic
1022703792 7:32784777-32784799 AAGCAGAGGTAGTGGGAGCCAGG - Intergenic
1022908032 7:34874903-34874925 AAGCAGAGGTAGTTGGAGCCAGG - Intronic
1023908972 7:44540722-44540744 TGGTAGTGGTGGTGGGAGTCGGG - Intronic
1025262924 7:57432760-57432782 TAGTTGAGTTTGTTGGAGCCAGG + Intergenic
1027424149 7:78045716-78045738 TTGTAAAGGAAATTGGAGTCAGG - Intronic
1029370585 7:100148346-100148368 TTGTAGAGGTGGTTGGAGCGGGG + Intergenic
1031195681 7:118610205-118610227 TTGTAGTGGGAGGTGGAGTCAGG + Intergenic
1036472730 8:9065189-9065211 TACTATAGATAGTTGGTGTCAGG - Intronic
1044701482 8:94969059-94969081 TTGCAGAAGAAGTTGGAGTCTGG + Intronic
1045762846 8:105630844-105630866 TAGTAGTGGTGGTTGGAGGGAGG + Intronic
1046306159 8:112370085-112370107 TAGTAGTAGTAGTAGTAGTCAGG + Intronic
1046707712 8:117474562-117474584 AAGTGCAGGTAGTTGAAGTCTGG - Intergenic
1048379032 8:133847598-133847620 TGGGAGATGTAGTTGGAGTGGGG - Intergenic
1054999065 9:71427751-71427773 TAGTAGAGGGAGGAGGAGGCAGG + Intronic
1056196026 9:84229325-84229347 TAGCAAAGGAAGTTGGAGTCAGG - Intergenic
1188668687 X:32856660-32856682 TAGTATGGGTAGTTGGGGACAGG + Intronic
1195958681 X:110362371-110362393 TATTAGAGGGAGTCTGAGTCAGG - Intronic
1196161089 X:112483414-112483436 TAGTAGTGGTAGTTGGGGTCTGG - Intergenic
1198594899 X:138225721-138225743 AGGTAGAGCCAGTTGGAGTCAGG - Intergenic
1201286913 Y:12387140-12387162 TGGTACAGGTGCTTGGAGTCAGG - Intergenic