ID: 1067844457

View in Genome Browser
Species Human (GRCh38)
Location 10:49708884-49708906
Sequence AGTTCACTTCAGAAGATGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 360}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067844457_1067844465 30 Left 1067844457 10:49708884-49708906 CCCACCATCTTCTGAAGTGAACT 0: 1
1: 0
2: 2
3: 33
4: 360
Right 1067844465 10:49708937-49708959 TTTCGCCCTGCTTTGGGATTTGG 0: 1
1: 0
2: 0
3: 14
4: 114
1067844457_1067844463 23 Left 1067844457 10:49708884-49708906 CCCACCATCTTCTGAAGTGAACT 0: 1
1: 0
2: 2
3: 33
4: 360
Right 1067844463 10:49708930-49708952 CCAGTGCTTTCGCCCTGCTTTGG 0: 1
1: 0
2: 0
3: 6
4: 92
1067844457_1067844464 24 Left 1067844457 10:49708884-49708906 CCCACCATCTTCTGAAGTGAACT 0: 1
1: 0
2: 2
3: 33
4: 360
Right 1067844464 10:49708931-49708953 CAGTGCTTTCGCCCTGCTTTGGG 0: 1
1: 0
2: 0
3: 11
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067844457 Original CRISPR AGTTCACTTCAGAAGATGGT GGG (reversed) Exonic
900434958 1:2625576-2625598 AGTTAACTGCAGAAGATAGCAGG - Intronic
900950248 1:5854597-5854619 AGCTCACTTCAGACCTTGGTGGG + Intergenic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905096007 1:35471477-35471499 AACACACTGCAGAAGATGGTAGG + Intronic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905465224 1:38148097-38148119 AGTTATCTGAAGAAGATGGTAGG - Intergenic
906228704 1:44141965-44141987 AGATCTCTTCAGAGGATGATAGG - Intergenic
907709420 1:56864823-56864845 AGTTCCCCTGAGAAGATGGTGGG - Intronic
908968074 1:69790421-69790443 AGCTCACTTCAGAATTTAGTTGG + Intronic
909438365 1:75670611-75670633 AGATCACTGGAGAAGAAGGTGGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910167912 1:84347321-84347343 AGTTCACCTCAGACCAGGGTTGG - Intronic
910342484 1:86203484-86203506 AGTTGAACTCAGCAGATGGTAGG - Intergenic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910550871 1:88473063-88473085 AGTACACTGCATAAGAAGGTTGG + Intergenic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
914358057 1:146905140-146905162 AGTGAATTTTAGAAGATGGTTGG - Intergenic
916262138 1:162852703-162852725 TGTTCACTTCTGTAGATGGCAGG + Intronic
916592736 1:166208329-166208351 AGCTCACTTCAGTATATGGTTGG + Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918429442 1:184443821-184443843 AGTGCACTTCAGGATATGCTTGG - Intronic
918433607 1:184487465-184487487 AGTTCACTTAAGAAGTGGGACGG + Intronic
918699417 1:187589356-187589378 TGTTCAGTTCAGAATAGGGTTGG - Intergenic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918958242 1:191237947-191237969 AGTTGTCTTCAGAAGATGGCAGG - Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
920653976 1:207861001-207861023 AGTTCATTTAGGAAGAAGGTAGG + Intergenic
920835131 1:209503339-209503361 AGATAAGTTCAGAAGATGGTTGG - Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1064561502 10:16599067-16599089 TGTTAGCTTCAGAGGATGGTGGG - Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1066307314 10:34158326-34158348 AGATGACTTCAGAAGATTCTAGG - Intronic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067844457 10:49708884-49708906 AGTTCACTTCAGAAGATGGTGGG - Exonic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069851869 10:71410650-71410672 AGTTAACTTCAGAGGATGACGGG - Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071673929 10:87637431-87637453 AGTTATCTTCAGAAGATGGTAGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1074639006 10:115357277-115357299 AGTACAGTTCAGAAGATTATAGG + Intronic
1074745036 10:116524029-116524051 ATTTCACTTCAGAAAATGGCAGG + Intergenic
1074898784 10:117799180-117799202 AGTTCACTCCTGGAGATGATAGG - Intergenic
1075898957 10:126022690-126022712 AGCTCCCTTCAGATGATGCTTGG - Intronic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077846950 11:6035760-6035782 TGTTATGTTCAGAAGATGGTGGG - Intergenic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081861179 11:46334044-46334066 AGTTGAATTAAGAAGATGTTGGG - Intronic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1085365856 11:75943708-75943730 AGTTCTATTGAGGAGATGGTAGG - Intronic
1086494864 11:87392142-87392164 TGTTCACTTTAGAAGATGCTAGG - Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1088840239 11:113620987-113621009 AGTTCACCTCTGAAGTGGGTTGG - Intergenic
1088959473 11:114648286-114648308 GGTTCAGTTCAAAAGCTGGTAGG + Intergenic
1089410422 11:118237012-118237034 AGAGCACTGCAGAAGAAGGTTGG + Intronic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097884634 12:64716735-64716757 AGGTCGCTACAGAAGATGTTTGG + Exonic
1098673038 12:73254217-73254239 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099735783 12:86565012-86565034 AGTTATCTGCAGAAGATAGTAGG - Intronic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1102962183 12:117099866-117099888 TGTTCACCTCAGAAGGTGCTGGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1104257293 12:127150818-127150840 AGTGCACTCCATAAAATGGTTGG - Intergenic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1106441520 13:29777542-29777564 AGTTCAATTCTGAACATTGTTGG - Intronic
1109712683 13:66180849-66180871 AGTTTTCTACAGAAGATGGCAGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1113099799 13:106704741-106704763 AAGTCACCTCAAAAGATGGTGGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1116645212 14:47519347-47519369 AGTTCTCTTCATAGGATGGAAGG + Intronic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1117980286 14:61336170-61336192 AGTTAACTTCAGAAAAGGGCTGG - Intronic
1118079601 14:62343127-62343149 AGTTCACATCTGGAGAAGGTAGG + Intergenic
1118473959 14:66100057-66100079 ATTTGACTTCAAAAGATAGTAGG - Intergenic
1118683333 14:68265854-68265876 AATTCACTCTAGTAGATGGTTGG + Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119521733 14:75291329-75291351 TGTTCTGTTCAGAAGATGGATGG - Intergenic
1119598090 14:75955228-75955250 ATTTCATTTCAGCAGATGGTGGG + Intronic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120286960 14:82515237-82515259 AGTACACTTCACAGGATGGGAGG - Intergenic
1120445120 14:84585811-84585833 AGTTCACTGCAGGAGAAGGGAGG - Intergenic
1122038698 14:98966697-98966719 AGTTCACTTCAGAGGGAGGATGG + Intergenic
1122350534 14:101087360-101087382 AGTTCACTCCAGATGCTGTTGGG + Intergenic
1125218099 15:37302018-37302040 AAATCACTGCAGAAGAAGGTCGG + Intergenic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1129799433 15:78402672-78402694 TGTTCACTGCAGATGTTGGTAGG + Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1131763866 15:95654163-95654185 AGTTCACTGCAGAAGCAGCTAGG + Intergenic
1134238674 16:12487666-12487688 AAGACAATTCAGAAGATGGTGGG + Intronic
1134638915 16:15813603-15813625 AATTCCCATGAGAAGATGGTAGG + Intronic
1135703380 16:24653018-24653040 ATTTCAATTTAGAAAATGGTTGG - Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1139976129 16:70812152-70812174 AGTGAATTTTAGAAGATGGTTGG + Intronic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1141883132 16:86873036-86873058 AGTGCACTGCAGAAAATGGAAGG + Intergenic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1148987237 17:51633678-51633700 AGTGCATTTAAGAGGATGGTTGG - Intronic
1149423153 17:56530293-56530315 GGTTCTATTCCGAAGATGGTGGG + Intergenic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151051602 17:70984592-70984614 ATTTCTCCTCAGAAGATGATGGG + Intergenic
1153089704 18:1330131-1330153 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155435489 18:25808320-25808342 GGTTCACTTAAGAAGATGTTAGG + Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1156829889 18:41479022-41479044 AGTTGACTTCATGATATGGTAGG + Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1158503138 18:58021806-58021828 AGTTCACCTCCGAAGGTGGTGGG + Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1159869440 18:73743826-73743848 AGTTCAGGTTAGAAGACGGTGGG - Intergenic
1160284468 18:77527978-77528000 AGTTTACTTCAGAAAAATGTGGG - Intergenic
1161486208 19:4537166-4537188 AGTTGATTTGAGAAGATGCTAGG + Exonic
1161932675 19:7351227-7351249 AGAACATTTCAGAAGATGGTGGG - Intronic
1163609711 19:18294558-18294580 AGCCCCCTTCAGGAGATGGTGGG + Intergenic
1163782919 19:19259791-19259813 AGTTCTCTTTAGAAGATTCTAGG - Intronic
1165048897 19:33128744-33128766 AGATTCCTTCAGATGATGGTAGG + Intronic
1166666801 19:44684967-44684989 AGTTGACGTCAGGAGATGGACGG + Intergenic
1166940628 19:46362637-46362659 ATTTAACTTGAGATGATGGTTGG - Intronic
1167951576 19:53031895-53031917 AGTTATCTGCAGAGGATGGTAGG - Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
926692940 2:15749738-15749760 ATTTCACTTCTGAAAATGGCTGG + Intergenic
927361740 2:22243333-22243355 AGTTCACTACACAAGAAGGATGG + Intergenic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
935183932 2:100714870-100714892 AGTTATTTTCAGAAGATGGTAGG - Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
936502617 2:113078152-113078174 AATTCACATGAGAAGATGGGTGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946703777 2:222437821-222437843 AGTTATCTGCAGAAAATGGTAGG + Intronic
946839178 2:223802861-223802883 GTTTCACTACAGAAAATGGTTGG - Intronic
947004753 2:225498272-225498294 AGTTCACTAAAGAAGAGAGTGGG + Intronic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
948087915 2:235266449-235266471 AGCTCACCCCAGGAGATGGTTGG - Intergenic
1170024417 20:11873317-11873339 AGCTCACTTCTGAAGGTAGTTGG + Intergenic
1173083741 20:39894785-39894807 ACTTTACCTCAGAAGATGGGTGG - Intergenic
1173465694 20:43279481-43279503 AGTTCATTGAGGAAGATGGTAGG - Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177194952 21:17894387-17894409 AGGTCACTTCTGAAGGTGGTAGG + Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181336021 22:22129591-22129613 ATTTAGATTCAGAAGATGGTGGG + Intergenic
1182426540 22:30276255-30276277 AGGCAACTGCAGAAGATGGTGGG + Intergenic
1182847026 22:33439716-33439738 AAATCACCTAAGAAGATGGTGGG - Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951077822 3:18418225-18418247 AGTCATCTTCAGAAGTTGGTAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951549258 3:23860620-23860642 AGTTCACTTGATACGTTGGTTGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
954886990 3:53883428-53883450 AGTTATCTTCAGCACATGGTAGG + Intergenic
955086999 3:55712484-55712506 ACTTCTCTGCAGAAGATTGTTGG + Intronic
956165335 3:66394287-66394309 TGTTCACTTGAGAAGCTGATTGG - Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957534033 3:81477723-81477745 AGTTCTCTTCAGTAAAAGGTAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959377348 3:105602864-105602886 AGTTATCTGCGGAAGATGGTAGG + Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960349526 3:116575671-116575693 AGTTATCTTCAGAAAATGGCAGG - Intronic
960493599 3:118349121-118349143 ATTTCATTTCAGAAAATAGTTGG + Intergenic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
961921491 3:130430992-130431014 AGATCATTTCAGAAGATTTTGGG + Intronic
963258482 3:143169861-143169883 AGATAGCCTCAGAAGATGGTAGG - Intergenic
963529761 3:146460374-146460396 AGATCACTTTAGATCATGGTGGG - Intronic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
967288775 3:187899012-187899034 AGGTAACTTCAGAAGATCGTAGG - Intergenic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
971125928 4:23754310-23754332 AGTTCACTACAGAAGATATATGG - Intergenic
971780593 4:31029318-31029340 AGCTTGCTTCTGAAGATGGTGGG + Intronic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
972591422 4:40491811-40491833 GGTTGACTTCTGAAGGTGGTAGG - Intronic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974289565 4:59912712-59912734 AGTTAACTGTAGAAGATGGCAGG - Intergenic
974357307 4:60829643-60829665 GTTGCACTACAGAAGATGGTGGG - Intergenic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980825107 4:138063519-138063541 ACTTCATTCCTGAAGATGGTGGG - Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983727737 4:170950309-170950331 AGTTCACTTTATTAGATAGTTGG + Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986959836 5:13199189-13199211 AGTTAACTGCAGAAGATGGCAGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987504385 5:18749824-18749846 AGTTAACTACAGAAGATGACAGG - Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988228766 5:28448097-28448119 ATTTATCTGCAGAAGATGGTAGG - Intergenic
988716166 5:33830241-33830263 AGATCCCTTCAGAAGATAGAGGG + Intronic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
990999126 5:61765281-61765303 AATTCACTTTAGAACAAGGTGGG + Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993319825 5:86458549-86458571 AGTTATCTGCAGAAGATAGTAGG - Intergenic
993325476 5:86529681-86529703 AGTTCTACTCAGAACATGGTGGG + Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
996468609 5:123833176-123833198 AGTTCAGTTTAGAAAATGTTAGG - Intergenic
996807048 5:127467861-127467883 AGTTCAGGGAAGAAGATGGTGGG - Intergenic
998290339 5:140908580-140908602 AGTTAGCTGCAGAAGATGGAAGG + Intronic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1001706921 5:173748240-173748262 AGTTCACTTCAGAAGGTAGATGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003791217 6:9549963-9549985 AGTTATCTTCAGAAGATGGTAGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006120408 6:31801382-31801404 ATTTCACTGCTGGAGATGGTGGG - Intronic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008490743 6:52084254-52084276 ACTTCACATCTGAAGGTGGTGGG + Intronic
1008967927 6:57333447-57333469 AGTTCACTACACAAGAGAGTGGG - Intronic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011727119 6:90221126-90221148 ATTTCACTTCAGAACAAGTTTGG - Intronic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1014416983 6:121195361-121195383 GGTTATCTGCAGAAGATGGTAGG - Intronic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014538833 6:122649790-122649812 AGCTGTCTTCAGAAGATGGCAGG + Intronic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1014826056 6:126049901-126049923 AGTCAAGTTCAGAAGATGATAGG + Intergenic
1015443289 6:133272593-133272615 AGTTATCTGTAGAAGATGGTTGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018404178 6:163459651-163459673 GGTTCACTTCATAGGATTGTTGG + Intronic
1018444211 6:163840543-163840565 AGTTCACTTCAGAAATTTGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020228318 7:6297673-6297695 GGTTAACATCAGAAGAGGGTAGG - Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021924240 7:25519514-25519536 AGTTCACTTGAGAGGAAGCTAGG - Intergenic
1022279215 7:28889304-28889326 AGTTCCCTTCACAACCTGGTTGG - Intergenic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1030173274 7:106626211-106626233 AATTCACCTCAGAAAATGGGAGG + Intergenic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1031940900 7:127787894-127787916 AGATCCCTTCAGAAAATGTTTGG - Intronic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032666794 7:134044862-134044884 AGTTCAAATCAGAAAATGCTTGG - Intronic
1035109561 7:156470095-156470117 AGTTTACTTCATAAGCTGGAAGG - Intergenic
1036713285 8:11097032-11097054 AGTTCCATCCAGAAGATGGAAGG + Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1038047335 8:23776686-23776708 AGAACATTTCAGAAGGTGGTTGG + Intergenic
1038055011 8:23849967-23849989 AGCCCACTTGAGAAAATGGTTGG + Intronic
1038976866 8:32707917-32707939 ATATAACTTCAGAAGATGATGGG - Intronic
1039601431 8:38841637-38841659 GGTTCATTTTAGAAGATGGCAGG + Intronic
1039780672 8:40781920-40781942 AGTTAACTTCTGTATATGGTAGG - Intronic
1040588280 8:48764877-48764899 AGTTCTCTTGAGAAGAGGGGTGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042697010 8:71565361-71565383 ACTTTAATTCAGAGGATGGTTGG + Intronic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1044667612 8:94647041-94647063 AGTTAACTTCAGTAGCTTGTGGG + Intronic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1045971767 8:108086379-108086401 GGTATACTTCAGAAGATGTTTGG + Intergenic
1046055064 8:109069714-109069736 TGTTCACTGTAGAAGATGCTTGG - Intergenic
1049191648 8:141291423-141291445 AGTTTACTTCAGAATTTAGTTGG + Intronic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1053188530 9:36039073-36039095 AGCGCACTTCAGAAAATGCTGGG + Intronic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058430537 9:104914560-104914582 AGTACACTAGAGAAGATTGTAGG - Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1187007498 X:15246985-15247007 AGCCCAATTCAGAACATGGTTGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1187711678 X:22060701-22060723 ATTTCACTTTAGAAGATTGTGGG + Intronic
1188550213 X:31355965-31355987 ACTTCATTCCAGAAGATGGCCGG - Intronic
1190467541 X:50740953-50740975 AGTTGATTTCTGTAGATGGTGGG + Intronic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192531689 X:71893168-71893190 AGTTATCTGCAGAGGATGGTAGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196981516 X:121219424-121219446 AGTTCAGTTCTGAAAATGTTTGG - Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1197926380 X:131650977-131650999 ACTTCAATTCAGAAGAGGCTTGG + Intergenic
1198805632 X:140491433-140491455 AGTTCACTTAAGTGGCTGGTGGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1201509057 Y:14737229-14737251 AGTCCACTTTGGAAAATGGTTGG - Intronic