ID: 1067848612

View in Genome Browser
Species Human (GRCh38)
Location 10:49741070-49741092
Sequence GCGCCCACACACCACGCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067848595_1067848612 23 Left 1067848595 10:49741024-49741046 CCTGTCCCCCACCAGGCCTCCCC 0: 1
1: 0
2: 4
3: 91
4: 823
Right 1067848612 10:49741070-49741092 GCGCCCACACACCACGCACTGGG No data
1067848600_1067848612 12 Left 1067848600 10:49741035-49741057 CCAGGCCTCCCCAGCCTGCCCCC 0: 1
1: 0
2: 11
3: 209
4: 1603
Right 1067848612 10:49741070-49741092 GCGCCCACACACCACGCACTGGG No data
1067848607_1067848612 -7 Left 1067848607 10:49741054-49741076 CCCCTGCCTGCTAGCAGCGCCCA 0: 1
1: 0
2: 0
3: 19
4: 243
Right 1067848612 10:49741070-49741092 GCGCCCACACACCACGCACTGGG No data
1067848598_1067848612 16 Left 1067848598 10:49741031-49741053 CCCACCAGGCCTCCCCAGCCTGC 0: 1
1: 0
2: 4
3: 59
4: 626
Right 1067848612 10:49741070-49741092 GCGCCCACACACCACGCACTGGG No data
1067848593_1067848612 30 Left 1067848593 10:49741017-49741039 CCTGCAGCCTGTCCCCCACCAGG 0: 1
1: 0
2: 4
3: 53
4: 534
Right 1067848612 10:49741070-49741092 GCGCCCACACACCACGCACTGGG No data
1067848599_1067848612 15 Left 1067848599 10:49741032-49741054 CCACCAGGCCTCCCCAGCCTGCC 0: 1
1: 0
2: 11
3: 126
4: 993
Right 1067848612 10:49741070-49741092 GCGCCCACACACCACGCACTGGG No data
1067848604_1067848612 2 Left 1067848604 10:49741045-49741067 CCAGCCTGCCCCCTGCCTGCTAG 0: 1
1: 1
2: 4
3: 68
4: 634
Right 1067848612 10:49741070-49741092 GCGCCCACACACCACGCACTGGG No data
1067848609_1067848612 -9 Left 1067848609 10:49741056-49741078 CCTGCCTGCTAGCAGCGCCCACA 0: 1
1: 0
2: 2
3: 12
4: 172
Right 1067848612 10:49741070-49741092 GCGCCCACACACCACGCACTGGG No data
1067848602_1067848612 4 Left 1067848602 10:49741043-49741065 CCCCAGCCTGCCCCCTGCCTGCT 0: 1
1: 2
2: 15
3: 266
4: 2073
Right 1067848612 10:49741070-49741092 GCGCCCACACACCACGCACTGGG No data
1067848597_1067848612 17 Left 1067848597 10:49741030-49741052 CCCCACCAGGCCTCCCCAGCCTG 0: 1
1: 0
2: 7
3: 95
4: 826
Right 1067848612 10:49741070-49741092 GCGCCCACACACCACGCACTGGG No data
1067848596_1067848612 18 Left 1067848596 10:49741029-49741051 CCCCCACCAGGCCTCCCCAGCCT 0: 1
1: 2
2: 4
3: 98
4: 869
Right 1067848612 10:49741070-49741092 GCGCCCACACACCACGCACTGGG No data
1067848603_1067848612 3 Left 1067848603 10:49741044-49741066 CCCAGCCTGCCCCCTGCCTGCTA 0: 1
1: 2
2: 4
3: 78
4: 550
Right 1067848612 10:49741070-49741092 GCGCCCACACACCACGCACTGGG No data
1067848608_1067848612 -8 Left 1067848608 10:49741055-49741077 CCCTGCCTGCTAGCAGCGCCCAC 0: 1
1: 0
2: 1
3: 17
4: 181
Right 1067848612 10:49741070-49741092 GCGCCCACACACCACGCACTGGG No data
1067848605_1067848612 -2 Left 1067848605 10:49741049-49741071 CCTGCCCCCTGCCTGCTAGCAGC 0: 1
1: 0
2: 0
3: 51
4: 462
Right 1067848612 10:49741070-49741092 GCGCCCACACACCACGCACTGGG No data
1067848606_1067848612 -6 Left 1067848606 10:49741053-49741075 CCCCCTGCCTGCTAGCAGCGCCC 0: 1
1: 0
2: 0
3: 20
4: 253
Right 1067848612 10:49741070-49741092 GCGCCCACACACCACGCACTGGG No data
1067848601_1067848612 7 Left 1067848601 10:49741040-49741062 CCTCCCCAGCCTGCCCCCTGCCT 0: 1
1: 3
2: 25
3: 211
4: 1933
Right 1067848612 10:49741070-49741092 GCGCCCACACACCACGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067848612 Original CRISPR GCGCCCACACACCACGCACT GGG Intronic
No off target data available for this crispr