ID: 1067849357

View in Genome Browser
Species Human (GRCh38)
Location 10:49745009-49745031
Sequence CCACCTTCATGGAGCTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067849357_1067849363 7 Left 1067849357 10:49745009-49745031 CCCTCAGAGCTCCATGAAGGTGG No data
Right 1067849363 10:49745039-49745061 AACACTCCATAGATAATTATGGG No data
1067849357_1067849366 24 Left 1067849357 10:49745009-49745031 CCCTCAGAGCTCCATGAAGGTGG No data
Right 1067849366 10:49745056-49745078 TATGGGGACAACCCCAGCTCAGG No data
1067849357_1067849362 6 Left 1067849357 10:49745009-49745031 CCCTCAGAGCTCCATGAAGGTGG No data
Right 1067849362 10:49745038-49745060 GAACACTCCATAGATAATTATGG No data
1067849357_1067849364 8 Left 1067849357 10:49745009-49745031 CCCTCAGAGCTCCATGAAGGTGG No data
Right 1067849364 10:49745040-49745062 ACACTCCATAGATAATTATGGGG No data
1067849357_1067849367 25 Left 1067849357 10:49745009-49745031 CCCTCAGAGCTCCATGAAGGTGG No data
Right 1067849367 10:49745057-49745079 ATGGGGACAACCCCAGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067849357 Original CRISPR CCACCTTCATGGAGCTCTGA GGG (reversed) Intronic