ID: 1067852461

View in Genome Browser
Species Human (GRCh38)
Location 10:49762354-49762376
Sequence TCTCAGGGGCGCGCGCCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 31}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067852461_1067852469 23 Left 1067852461 10:49762354-49762376 CCCACGGGCGCGCGCCCCTGAGA 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1067852469 10:49762400-49762422 TGGATGCCCCGCCCCGCTCCTGG 0: 1
1: 0
2: 1
3: 25
4: 238
1067852461_1067852467 3 Left 1067852461 10:49762354-49762376 CCCACGGGCGCGCGCCCCTGAGA 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1067852467 10:49762380-49762402 CGCGCGTCGTGACGTCTCCATGG 0: 1
1: 0
2: 0
3: 0
4: 11

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067852461 Original CRISPR TCTCAGGGGCGCGCGCCCGT GGG (reversed) Intronic
915233771 1:154465472-154465494 TCTCAGGGGTGTGCGGCCTTTGG + Exonic
1067852461 10:49762354-49762376 TCTCAGGGGCGCGCGCCCGTGGG - Intronic
1081290140 11:41314644-41314666 TGTCAGGGGTGCGGGGCCGTGGG + Intronic
1085165895 11:74398755-74398777 TCTTGGGGGCACGCGCCGGTTGG + Intergenic
1095829587 12:46569927-46569949 TCTCAGGCGTGCGCGCCTCTGGG - Intergenic
1105943483 13:25170955-25170977 GCGGAGGGGCGCGCGCCCGGGGG - Exonic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1128496307 15:68200496-68200518 TCCCAGGGCCGGGAGCCCGTGGG - Intronic
1132314493 15:100880029-100880051 GCGCAGGGGCCCGCGGCCGTCGG - Intronic
1132398319 15:101489840-101489862 TCGCAGGAGCGCGGGCCCGGGGG - Intronic
1147422023 17:40326677-40326699 TCTCAGGGGAGGGTGCCCGTGGG + Intronic
1148446760 17:47742759-47742781 TGCCAGGTGCGCGCGCCCCTGGG + Exonic
1148558757 17:48594056-48594078 TCTCACGCCCGCGCTCCCGTCGG - Intronic
1150548957 17:66191831-66191853 CCTGGGGGGCGCGCGCCCCTGGG - Exonic
1154165825 18:12013623-12013645 TCACAGAGGCACGCGGCCGTGGG + Intronic
1165148724 19:33748967-33748989 CCTCAGGGGTGTGCGCCTGTTGG - Intronic
1167730508 19:51250857-51250879 TCCCAGGGGCACACGCCTGTGGG + Intronic
938293391 2:130162145-130162167 CCTCAGGGGCTCCCGCCCTTGGG - Intronic
938343273 2:130549288-130549310 TGTCAGGGGCGACGGCCCGTGGG + Intronic
938346560 2:130571434-130571456 TGTCAGGGGCGACGGCCCGTGGG - Intronic
938463162 2:131510816-131510838 CCTCAGGGGCTCCCGCCCTTGGG + Intergenic
948385210 2:237576570-237576592 TCTTTGGGAGGCGCGCCCGTCGG + Intronic
949079827 2:242088283-242088305 TCTCAGGGACGCGCGTCCTCAGG + Intergenic
1181064294 22:20298512-20298534 CCTCAGTGCCGCCCGCCCGTGGG - Intergenic
1183423539 22:37725679-37725701 TCTCAGGGGCGCGGGGCTCTGGG - Exonic
972713191 4:41619338-41619360 TCTCAGAGGCGCGGGGACGTAGG - Exonic
986747945 5:10760861-10760883 TCTCCGCGGCCCGCGCCCCTCGG + Intronic
1006518201 6:34556137-34556159 TCTCAGGGCTGCGTGCCTGTAGG + Exonic
1014802317 6:125790872-125790894 GCTCCGAGGCGCGCGCCCGCGGG - Exonic
1035537879 8:406568-406590 TCTCAGGGACGCGCGTCCTCAGG + Intronic
1048986450 8:139737535-139737557 TCTCTGGGGCTGGCCCCCGTCGG + Intronic
1049457311 8:142700332-142700354 TCTCAGGGCCTCGCGGCCGCTGG - Exonic
1049769869 8:144374778-144374800 TCTCAGGGGCGCGCCCCCCATGG + Intronic
1198797184 X:140410116-140410138 TATCAGGGGAGCACCCCCGTGGG - Intergenic