ID: 1067859819

View in Genome Browser
Species Human (GRCh38)
Location 10:49834389-49834411
Sequence TACTGCTGTCTCTAAATAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067859816_1067859819 28 Left 1067859816 10:49834338-49834360 CCTAGTTCATTTCTCTGTTTTAT 0: 1
1: 0
2: 8
3: 73
4: 1015
Right 1067859819 10:49834389-49834411 TACTGCTGTCTCTAAATAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067859819 Original CRISPR TACTGCTGTCTCTAAATAAC TGG Intronic
No off target data available for this crispr