ID: 1067862139

View in Genome Browser
Species Human (GRCh38)
Location 10:49861581-49861603
Sequence CACCTACCTGTAGCATGCCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067862138_1067862139 1 Left 1067862138 10:49861557-49861579 CCATACACAGACACTACTAAGAT 0: 2
1: 0
2: 2
3: 8
4: 166
Right 1067862139 10:49861581-49861603 CACCTACCTGTAGCATGCCTTGG 0: 2
1: 0
2: 0
3: 12
4: 232
1067862137_1067862139 6 Left 1067862137 10:49861552-49861574 CCTAACCATACACAGACACTACT 0: 2
1: 0
2: 1
3: 12
4: 210
Right 1067862139 10:49861581-49861603 CACCTACCTGTAGCATGCCTTGG 0: 2
1: 0
2: 0
3: 12
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067862139 Original CRISPR CACCTACCTGTAGCATGCCT TGG Exonic
901100626 1:6715912-6715934 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
901471823 1:9462212-9462234 TACCTAGCAGTAGAATGCCTAGG + Intergenic
902062501 1:13657747-13657769 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
904831756 1:33309942-33309964 CACCTACCAGCTGCCTGCCTTGG - Intronic
904877097 1:33663555-33663577 CCCCTACCTGCACCATGGCTGGG - Intronic
905427246 1:37895870-37895892 CACCTCCCAGCAGCCTGCCTTGG + Intronic
905463853 1:38138440-38138462 CACCTGTCTCTAGCATGACTGGG - Intergenic
905686731 1:39913654-39913676 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
908000222 1:59672093-59672115 CACCCATCTGTATCATTCCTAGG + Intronic
908037139 1:60068099-60068121 CCCCCACCTTTAGCATGCCAGGG + Intronic
910204851 1:84739641-84739663 CAAATACCTGTGGCATGTCTGGG - Intergenic
911598483 1:99823312-99823334 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
912371554 1:109177579-109177601 CACCTCCCAGCAGCCTGCCTTGG - Intronic
915208284 1:154287277-154287299 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
916104688 1:161422608-161422630 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
917113420 1:171576370-171576392 CATCTACCAGTAGGATGACTAGG - Intronic
917553215 1:176057692-176057714 CACCTCCCAGCAGCCTGCCTTGG + Intronic
917583250 1:176397241-176397263 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
917604386 1:176611678-176611700 CTCCTATCTGTAGCATTCTTGGG + Intronic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
917859785 1:179135087-179135109 CACCTCCCAGCAGCCTGCCTTGG + Intronic
919079878 1:192856702-192856724 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
919926002 1:202192124-202192146 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
920152577 1:203920315-203920337 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
920740442 1:208576864-208576886 CAGCTTCCTGGAACATGCCTTGG + Intergenic
920842339 1:209565288-209565310 CACCTACCTGAACCATTCCAAGG - Intergenic
921197991 1:212778756-212778778 CACCTCCCAGCAGCCTGCCTTGG + Intronic
921638537 1:217524499-217524521 CACCTCCCAGCAGCCTGCCTTGG - Intronic
922278417 1:224100574-224100596 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
923224414 1:231925812-231925834 CAGCAACCCGTAGCATGCCTTGG - Intronic
923664154 1:235983935-235983957 CACCAACCTGTACCATGCTAAGG + Intronic
1064613347 10:17126754-17126776 GACCTACCTGCTGCAAGCCTTGG + Exonic
1067393815 10:45892425-45892447 CACCTACCTGTAGCATGCCTCGG + Intergenic
1067862139 10:49861581-49861603 CACCTACCTGTAGCATGCCTTGG + Exonic
1069365545 10:67691249-67691271 CACCTCCCAGCAGCCTGCCTTGG + Intronic
1069539144 10:69280446-69280468 CACCTACCTGGATCTTGTCTTGG + Intronic
1069929076 10:71870083-71870105 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1070135352 10:73689344-73689366 CACCTTCCAGCAGCCTGCCTTGG + Intronic
1070288319 10:75099422-75099444 CACCTACCTGGGGCATGGCCTGG + Intronic
1070636568 10:78133240-78133262 CACCTACAAGTAACATGGCTGGG - Intergenic
1070782036 10:79143262-79143284 CACCCACCAGTAGTATGTCTTGG + Intronic
1071818526 10:89256117-89256139 CAGCCACCTTTAGCCTGCCTAGG - Intronic
1074587906 10:114786852-114786874 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
1075137306 10:119795716-119795738 CACCTCCCAGCAGCCTGCCTTGG - Intronic
1075407393 10:122203796-122203818 CACCTCCCAGCAGCCTGCCTTGG - Intronic
1075948084 10:126454974-126454996 CACCTTCCCTTGGCATGCCTGGG + Intronic
1077343513 11:2036345-2036367 CACCTCCCTGTAGCCTGGCCCGG - Intergenic
1079372115 11:19860669-19860691 CACCTCCCAGCAGCCTGCCTTGG - Intronic
1079551566 11:21705300-21705322 CACCTTCCTGTAGCAAGTCAGGG - Intergenic
1081950552 11:47039141-47039163 CACCTCCCAGCAGCCTGCCTTGG - Intronic
1082873335 11:57963743-57963765 GCCTTACCTGCAGCATGCCTTGG - Intergenic
1084484888 11:69442514-69442536 CACCTACCCTGAGCATGGCTGGG - Intergenic
1084745830 11:71168463-71168485 CACCTCCCAGCAGCCTGCCTTGG - Intronic
1085039805 11:73320173-73320195 CACCTCCCTGAAGCCTCCCTAGG - Intronic
1085112162 11:73897820-73897842 CACCTCCCAGCAGCCTGCCTTGG - Intronic
1085563089 11:77489806-77489828 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
1086273630 11:85097407-85097429 CACCTCTCAGTACCATGCCTGGG + Intronic
1086792724 11:91063213-91063235 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
1088115406 11:106306496-106306518 CCCCTACCTGTTACATGACTTGG + Intergenic
1089522413 11:119074016-119074038 CCCCTACCTGGAGCATGGATGGG - Intronic
1202826499 11_KI270721v1_random:91534-91556 CACCTCCCTGTAGCCTGGCCCGG - Intergenic
1092401664 12:8183738-8183760 CACCTCCCAGCAGCCTGCCTTGG + Intronic
1096441004 12:51644592-51644614 CACCTCCCAGCAGCCTGCCTTGG + Intronic
1099255643 12:80308605-80308627 CACCTCCCAGCAGCCTGCCTTGG - Intronic
1100048155 12:90410928-90410950 CACCTCCCAGCCGCATGCCTTGG + Intergenic
1100577719 12:95908100-95908122 CACCTCCCGGCAGCCTGCCTTGG - Intronic
1101735129 12:107457722-107457744 CAGCTGCCTGTTGCATGCCAAGG + Intronic
1102941958 12:116950856-116950878 CACCAAACTGTAGCATCCGTGGG - Intronic
1106560318 13:30840244-30840266 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1107492999 13:40900106-40900128 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
1112056281 13:95691693-95691715 CACCTCCCAGCAGCCTGCCTTGG - Intronic
1114280405 14:21188577-21188599 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
1118363096 14:65072226-65072248 CTCATTTCTGTAGCATGCCTAGG - Intronic
1120159378 14:81129455-81129477 CACCCACCTGCTGCAGGCCTGGG + Intronic
1120505889 14:85353108-85353130 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1123145869 14:106129482-106129504 AACCTCCCTGCAGAATGCCTGGG - Intergenic
1126892284 15:53219241-53219263 CCCCAACCTCTGGCATGCCTAGG - Intergenic
1127153988 15:56109403-56109425 CACCTCCCAGCAGCCTGCCTTGG + Intronic
1128794328 15:70453784-70453806 CATCTACTTGTAGCAGGCATCGG + Intergenic
1129246734 15:74283417-74283439 CACCTGCCTGTTGCCTGCCTGGG - Intronic
1131066052 15:89435704-89435726 CCCCTGCCTGTGGCCTGCCTGGG + Intergenic
1131104415 15:89722124-89722146 CACTTACCTGTAACAGGCTTAGG - Exonic
1134082878 16:11336341-11336363 CACCTCCCAGCAGCCTGCCTTGG - Intronic
1137240899 16:46653762-46653784 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1139345271 16:66298861-66298883 CACACACCTGTAGACTGCCTGGG - Intergenic
1139355738 16:66366311-66366333 CACCTGCCTGTAGCATTCCAAGG + Intergenic
1139671257 16:68493520-68493542 CAACTACCTGCAGCCTCCCTTGG + Intergenic
1139908828 16:70384011-70384033 CACCTCCCTGTAGCCAGCCACGG + Intronic
1139936832 16:70577616-70577638 CAACTACTTGTGGCATGCATTGG + Exonic
1143277303 17:5721539-5721561 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1144860307 17:18297780-18297802 CACCTCCCAGCAGCCTGCCTTGG + Intronic
1148016216 17:44524382-44524404 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
1149526528 17:57360157-57360179 CAGCTACTTGGAGCAAGCCTGGG + Intronic
1149625213 17:58074851-58074873 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1149632921 17:58142186-58142208 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
1150213804 17:63456170-63456192 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
1152529376 17:80908048-80908070 CACCTGCCTGTAGGATTGCTGGG + Intronic
1152585736 17:81188681-81188703 TTCCTACCTGCAGCATGGCTAGG - Intergenic
1153251334 18:3125213-3125235 CACCTAAATGTAGAATGGCTGGG - Intronic
1153605570 18:6827989-6828011 CACCTCCCAGCAGCCTGCCTTGG - Intronic
1153638486 18:7134143-7134165 CACCGTCCTGCAGGATGCCTTGG + Intergenic
1153646912 18:7203874-7203896 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1158459447 18:57633510-57633532 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1160182115 18:76645288-76645310 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
1160944418 19:1634588-1634610 CACCAGCCTGGAGCATTCCTTGG - Intronic
1162278866 19:9679698-9679720 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
1162413670 19:10521093-10521115 CTCCCGCCTGAAGCATGCCTAGG + Intergenic
1162791406 19:13064940-13064962 CACCTACCATTAGCATTCCTGGG - Intronic
1163542119 19:17917955-17917977 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
1163609462 19:18293370-18293392 CTCCTACCGGGAGCCTGCCTGGG - Intergenic
1164298609 19:23937783-23937805 CACCTCCCAGCAGCCTGCCTTGG - Intronic
1164798662 19:31057642-31057664 AGCCTATGTGTAGCATGCCTTGG + Intergenic
927757956 2:25723801-25723823 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
930821333 2:55650500-55650522 CACCTCCCAGCAGCCTGCCTTGG + Intronic
932367155 2:71160811-71160833 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
934223446 2:90107548-90107570 CACATAACTTTCGCATGCCTTGG + Intergenic
934548978 2:95243207-95243229 CACCTCCCAGCAGCCTGCCTTGG + Intronic
935016352 2:99186239-99186261 CACTTACCTGTAGTCTGCCTGGG - Exonic
937377632 2:121348505-121348527 GGCCTACCTGCAGCAAGCCTGGG + Exonic
938822059 2:134968988-134969010 CACCTCCCAGCAGCCTGCCTTGG - Intronic
939995424 2:148915246-148915268 CACCCTCCTCTAGCATCCCTGGG + Intronic
941024103 2:160439693-160439715 CACCTCCCAGCAGCCTGCCTTGG - Intronic
942352890 2:175071966-175071988 CACCTGCCTTTGGCATCCCTTGG - Intergenic
943142001 2:183993869-183993891 GCCCTCCCTGTAGCAGGCCTAGG - Intergenic
944255223 2:197618443-197618465 CACCTCCCAGCAGCCTGCCTTGG + Intronic
944797845 2:203206776-203206798 CACCTCCCAGCAGCCTGCCTTGG + Intronic
945049070 2:205806373-205806395 AACCTCCCTGTAGCCGGCCTGGG + Intergenic
945316760 2:208378011-208378033 CACCTCCCAGCAGCCTGCCTTGG - Intronic
946650852 2:221891852-221891874 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
948639910 2:239369027-239369049 CACCTTCCTGCAGCTTCCCTGGG - Intronic
1170848429 20:19981883-19981905 CACCTGCCTGCCCCATGCCTGGG + Intronic
1173769698 20:45646416-45646438 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1174020758 20:47526399-47526421 CACCTCCCAGCAGCCTGCCTTGG - Intronic
1174344754 20:49921807-49921829 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
1175667283 20:60871160-60871182 CACCTGCCTGGAGAATCCCTGGG - Intergenic
1176215414 20:63945486-63945508 GACCCAGCTGTGGCATGCCTGGG + Intronic
1176348538 21:5771445-5771467 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1176355352 21:5892029-5892051 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1176496289 21:7553010-7553032 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
1176542859 21:8169515-8169537 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1176561810 21:8352560-8352582 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1178075412 21:29011025-29011047 CACCTCCCAGCAGCCTGCCTTGG + Intronic
1179274743 21:39881921-39881943 CACATAGCTGTAACATGCTTGGG + Intronic
1180124987 21:45784818-45784840 CACCTCCCAGCAGCCTGCCTTGG + Intronic
1181181723 22:21073255-21073277 CCCCTCACTGCAGCATGCCTAGG + Intergenic
1181301638 22:21884419-21884441 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1181658125 22:24318159-24318181 CACCTCCCAGCAGCCTGCCTTGG - Intronic
1183940836 22:41294409-41294431 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
1184694093 22:46130277-46130299 CACCTACAGGGAGCATGCATGGG + Intergenic
1203247725 22_KI270733v1_random:85758-85780 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
950304094 3:11905102-11905124 CACTCACCTGCAGCAGGCCTGGG + Intergenic
950718288 3:14864989-14865011 CACCTACCAGTCACATGCCTAGG - Intronic
950949272 3:16980774-16980796 CACCTCCCAGCAGCCTGCCTTGG - Intronic
954356374 3:50085486-50085508 CACCTCCCAGCAGCCTGCCTTGG - Intronic
954399731 3:50312627-50312649 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
955106446 3:55903133-55903155 CAAATACCTGTATCATGCTTTGG + Intronic
955699910 3:61672358-61672380 CACCTCCCAGCAGCCTGCCTTGG - Intronic
956708409 3:72019354-72019376 CATCTAACTGTACCAGGCCTGGG + Intergenic
957977958 3:87471777-87471799 CACCTATCTGTAGCAGGCTTAGG - Intergenic
961164003 3:124750986-124751008 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
962274700 3:134003238-134003260 CACCTACCAGTTGCAGCCCTAGG + Intronic
968411549 4:395347-395369 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
968532256 4:1098691-1098713 CACCTAACTCCACCATGCCTCGG + Intronic
972288176 4:37668573-37668595 CACCTCCCAGCAGCCTGCCTTGG + Intronic
972654037 4:41049020-41049042 CACCTCCCAGCAGCCTGCCTTGG + Intronic
973108988 4:46377092-46377114 CACCTCCCAGCAGCCTGCCTTGG + Intronic
974945463 4:68522370-68522392 CAAATAGCTGAAGCATGCCTGGG - Intergenic
975042357 4:69761716-69761738 CACCTCCCAGCAGCCTGCCTTGG + Intronic
976445910 4:85129580-85129602 CACCTCCCTGTATCCTGACTGGG - Intergenic
976607312 4:86995669-86995691 CACCTCCCAGCAGCCTGCCTTGG + Intronic
979482786 4:121238337-121238359 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
982053736 4:151527162-151527184 CACCTCCCAGCAGCCTGCCTTGG - Intronic
986812391 5:11373896-11373918 CCCCTAGGTGTAGCATGCCAGGG - Intronic
988544226 5:32141961-32141983 CACCTCCCAGCAGCCTGCCTTGG + Intronic
989021614 5:37013846-37013868 CACCTCCCAGCAGCCTGCCTTGG - Intronic
989048346 5:37295404-37295426 CACCTCCCAGCAGCCTGCCTTGG + Intronic
990854868 5:60253328-60253350 CAACAACTTCTAGCATGCCTGGG - Intronic
991530008 5:67604595-67604617 CACCTGCCTGTTACATGCCCTGG - Intergenic
993496510 5:88615587-88615609 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
993816600 5:92556261-92556283 CACCTAACAGTAGCCTGCCTGGG - Intergenic
995123719 5:108559768-108559790 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
996783795 5:127216383-127216405 TACCTTCCTGCATCATGCCTTGG - Intergenic
997565404 5:134882481-134882503 CACCTCCCAGCAGCCTGCCTTGG - Intronic
997875076 5:137538717-137538739 CACCTCCCAGCAGCCTGCCTTGG - Intronic
998059973 5:139112202-139112224 CACCTCCCAGCAGCCTGCCTTGG + Intronic
998067335 5:139170224-139170246 CACCTCCCAGCAGCCTGCCTTGG + Intronic
998074352 5:139224234-139224256 CACCTCCCAGCAGCCTGCCTTGG + Intronic
998239590 5:140428274-140428296 CACCTCCCAGCAGCCTGCCTTGG - Intronic
999716859 5:154368046-154368068 CTCAAACCTTTAGCATGCCTAGG + Intronic
1000536463 5:162484543-162484565 CTCCTTACTGTAGCATTCCTGGG + Intergenic
1001467750 5:171983470-171983492 CACATACCAGTGGCAAGCCTGGG - Intronic
1001512473 5:172333583-172333605 CAACTAGCTGTAGCATGTGTAGG - Exonic
1002077687 5:176718613-176718635 CCCACACCTGTAGAATGCCTTGG + Intergenic
1002369584 5:178741053-178741075 CACCTTCCTCCATCATGCCTTGG + Intergenic
1004794480 6:19066038-19066060 CACCTACCTGAAGCCTGTCATGG - Intergenic
1005063701 6:21798009-21798031 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1005158642 6:22836091-22836113 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
1005421228 6:25653219-25653241 CACCTACCTCTAGAATACATGGG - Intronic
1006141618 6:31932754-31932776 CACCTCCCAGCAGCCTGCCTTGG - Intronic
1006281997 6:33060391-33060413 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1009712096 6:67336836-67336858 CAACTACCTCTAGCTTGCCCTGG - Intergenic
1013243796 6:108269572-108269594 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
1016802305 6:148179386-148179408 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1017215290 6:151900033-151900055 CACCTCCCAGCAGCCTGCCTTGG - Intronic
1017833159 6:158151032-158151054 TACCTACCTGTAAAATGCCTAGG + Intronic
1019701667 7:2477241-2477263 CACCCACCTGCAGCAGCCCTAGG - Intergenic
1020831607 7:13102311-13102333 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
1024281103 7:47720631-47720653 CACCTGCCTGCAGCATGCCCAGG + Intronic
1026862189 7:73797720-73797742 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1027440847 7:78217614-78217636 CATCTCCCTGTTGCATGCCTGGG - Intronic
1028227562 7:88267032-88267054 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1030329269 7:108255523-108255545 CACCTCCCAGCAGCCTGCCTTGG + Intronic
1034266484 7:149783506-149783528 CACCAGCCTGTGGCATTCCTTGG - Intergenic
1036742017 8:11371866-11371888 CACCTTCCTTTCGCATGGCTGGG + Intergenic
1037812892 8:22097329-22097351 CCCCTGCCTGCCGCATGCCTGGG - Intronic
1037812909 8:22097393-22097415 CCCCTGCCTGCCGCATGCCTGGG - Intronic
1038040169 8:23717448-23717470 CACCTACCCCAAGCATGCCCAGG - Intergenic
1038658142 8:29473028-29473050 CTCCTTCCTGTAGAATGCCTGGG + Intergenic
1039880551 8:41622710-41622732 CACCTACCTGTGACCTCCCTGGG + Exonic
1040093475 8:43420130-43420152 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1041287099 8:56272621-56272643 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1041677391 8:60549278-60549300 CACCTCCCAGCAGCCTGCCTTGG - Intronic
1041920957 8:63180612-63180634 CACCTCCCAGCAGCCTGCCTTGG - Intronic
1044223576 8:89698505-89698527 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
1046902703 8:119540008-119540030 CACAGACCTGTAGCATCCCGAGG - Intergenic
1047237888 8:123058452-123058474 CACCTAACTGTTGCCTGACTTGG + Intronic
1055241984 9:74197202-74197224 CACCTCCCAGCAGCCTGCCTTGG + Intergenic
1055789916 9:79912538-79912560 CACCTACCTGCAAGATACCTGGG + Intergenic
1057155212 9:92832097-92832119 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1057339128 9:94183367-94183389 CACCTGCCTGCATCATGCTTAGG + Intergenic
1058972733 9:110097799-110097821 CACCTCCCAGCAGCCTGCCTTGG - Intronic
1059707892 9:116841016-116841038 CACCTCCCAGCAGCCTGCCTTGG - Intronic
1060369763 9:123057691-123057713 CACCTACCAGCTGCCTGCCTTGG - Intronic
1061152824 9:128838446-128838468 CACCTTCCAGCAGCAGGCCTGGG + Intronic
1061427248 9:130506994-130507016 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1062265993 9:135686761-135686783 CACCTGTCTGTGGCCTGCCTTGG + Intergenic
1203464128 Un_GL000220v1:68993-69015 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1186245259 X:7609963-7609985 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1186923059 X:14303098-14303120 CACCTCCCAGCAGCCTGCCTTGG - Intergenic
1187183808 X:16965748-16965770 CACCTCCCAGCAGCCTGCCTTGG - Intronic
1187184425 X:16969364-16969386 CACCTCCCAGCAGCCTGCCTTGG - Intronic
1194861661 X:99006105-99006127 CACCTACCTTAAGCATGCTCAGG - Intergenic
1197524290 X:127543623-127543645 CACCTACCTTTTGTTTGCCTGGG + Intergenic
1199475666 X:148242461-148242483 CATCTACCTGAATAATGCCTGGG - Intergenic
1200230375 X:154440978-154441000 CTCCTACCTGCTGCCTGCCTGGG + Intronic
1201335699 Y:12878490-12878512 CACCTCCCAGCAGCCTGCCTTGG + Intergenic