ID: 1067862757

View in Genome Browser
Species Human (GRCh38)
Location 10:49870051-49870073
Sequence ATCTAGTTGTTTAATTAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 5, 2: 1, 3: 51, 4: 291}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067862757 Original CRISPR ATCTAGTTGTTTAATTAACA AGG (reversed) Intronic
900961062 1:5920448-5920470 AACTACTGGTTCAATTAACACGG - Intronic
901363303 1:8722812-8722834 TTCAAGTTCTTTAAATAACATGG - Intronic
903146192 1:21373716-21373738 CTCTAGTCTATTAATTAACATGG - Intergenic
903512423 1:23886315-23886337 ATCTACCTGTTTTATAAACAGGG - Intronic
904807551 1:33142490-33142512 TTCTAGTTGATTAATTGCCAGGG - Intergenic
908313561 1:62909952-62909974 ATCCAGTTGTGTAATTCACATGG - Intergenic
910144202 1:84059672-84059694 ATCTAATAGTCTAATCAACAGGG + Intergenic
913330336 1:117661963-117661985 ATCTAGTTGTTTAAAAATCTGGG + Intergenic
914931511 1:151938397-151938419 ATTTAGTAGTTTAAACAACATGG + Intergenic
917311881 1:173687377-173687399 AACTGGTTGTTTAAATAAAAGGG - Intergenic
918180646 1:182083907-182083929 CTCTAATTGTTTCAATAACAGGG + Intergenic
918827477 1:189343993-189344015 ATGTAGTTCTTAAATTAATATGG + Intergenic
921876117 1:220198376-220198398 ATCTATTTGTTGAAGCAACAAGG + Intronic
922713168 1:227848639-227848661 AGCTACTTGTTTATTTAAGAAGG - Intergenic
1062869951 10:892479-892501 ATATAGTTGTTTATTTGAGATGG - Intronic
1064428978 10:15255207-15255229 ATCTACTTGTTTCATTTACATGG - Intronic
1066090047 10:32008437-32008459 GTCTGGTTGTTTTATTAACCAGG - Intergenic
1066310715 10:34193079-34193101 ATTTACTTGTTTAATTCAAAAGG - Intronic
1066598559 10:37078875-37078897 ATATAGAGGTTTGATTAACATGG - Intergenic
1067366830 10:45639233-45639255 ATATAGGTGTTTTATTAAAAAGG + Intronic
1067862757 10:49870051-49870073 ATCTAGTTGTTTAATTAACAAGG - Intronic
1070953963 10:80452869-80452891 ATTTGTTTGTTTAATTAAGAGGG - Intergenic
1072343352 10:94477920-94477942 ATCTAGTCTTCTATTTAACAAGG - Intronic
1072514205 10:96162257-96162279 AACTGGTTGTTTAATTTAAAAGG + Exonic
1074522535 10:114238646-114238668 ATCTAATTGTATTATTAAAATGG + Intergenic
1078304003 11:10164215-10164237 ACCTAGATGTTTTATTAATAAGG - Intronic
1080948431 11:37001246-37001268 CTCTATGTGTTTATTTAACAAGG - Intergenic
1080988297 11:37498138-37498160 AGCTATTTTTTTATTTAACAAGG - Intergenic
1081202265 11:40231029-40231051 AAATATTTGTTTAAATAACAAGG + Intronic
1085891343 11:80583660-80583682 ATATAGAGGTTTAATTAACATGG + Intergenic
1086224988 11:84497069-84497091 ATCTATTTGTTTAATTAGTGAGG - Intronic
1086338011 11:85818695-85818717 ATCTATTTATTTATTTAAGACGG + Intergenic
1087454009 11:98360567-98360589 ATATAGTAGTTTATTTTACATGG + Intergenic
1087770142 11:102200341-102200363 CTATAGTTTTTTAATTAAAATGG + Intronic
1088439183 11:109849631-109849653 ATCTGGTTGTCAATTTAACATGG + Intergenic
1089052310 11:115556574-115556596 ATATAGTTTTTTAATTGAGACGG - Intergenic
1091188377 11:133667837-133667859 ATTTAGGTCTGTAATTAACACGG + Intergenic
1095219726 12:39595623-39595645 ATCTAGGAGATTAAGTAACATGG + Intronic
1095809603 12:46357794-46357816 ATCTGGTTTTTTACTTAAGAAGG - Intergenic
1096392691 12:51241470-51241492 TTCTACTTTTTTAATTATCAGGG - Intronic
1096721890 12:53529201-53529223 ATTTAGTTATTTATTTAAGACGG + Intronic
1097604621 12:61737800-61737822 ATCTAATTATTTAATAAATAAGG + Intronic
1098077529 12:66748825-66748847 AACCAATTGTTTAAATAACAGGG + Intronic
1098566796 12:71946189-71946211 TTCCAGTTGTTTTATTAACTAGG - Intronic
1099101660 12:78448834-78448856 ATTTAGTTGTTTCATTTTCATGG - Intergenic
1099678814 12:85797219-85797241 ATCTAGGGGTTTACTTATCAAGG + Intergenic
1099696316 12:86024950-86024972 ATATAGTTGTTAATATAACAAGG - Intronic
1100350629 12:93778186-93778208 GACTAGTTGTTTAATAACCATGG - Intronic
1100645554 12:96526416-96526438 ATTTAGTAGTATAAATAACAAGG - Intronic
1103751072 12:123161885-123161907 ATGTTGATGTTTAATTACCAGGG - Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1104060642 12:125265139-125265161 ATATAGTATTTTAATTCACAGGG + Intronic
1105059145 12:133131951-133131973 AATTAGTTAATTAATTAACAAGG - Intronic
1105252289 13:18710142-18710164 ATCAACTTGTTTAATCCACATGG - Intergenic
1105779430 13:23694113-23694135 ATTTAGATCTTTAATTCACAGGG - Intergenic
1106321952 13:28648466-28648488 ACATATCTGTTTAATTAACATGG + Intergenic
1107282862 13:38756386-38756408 ATGTTGTTGATTCATTAACACGG + Intronic
1109413532 13:62006028-62006050 ATCTAGTTGTTTATTTGTGATGG - Intergenic
1109611458 13:64770812-64770834 CTTTTTTTGTTTAATTAACATGG + Intergenic
1109699388 13:66005804-66005826 ATGTAATTGTTTACTTAATAAGG - Intergenic
1109912764 13:68937349-68937371 AGTGTGTTGTTTAATTAACATGG + Intergenic
1109930431 13:69209555-69209577 TGCTAGTTGTATAATTTACAAGG - Intergenic
1110246054 13:73325823-73325845 TTCTACTTGTTTACTTAACCTGG - Intergenic
1110572226 13:77017844-77017866 ATCTAGTAGTTTAATGTACTAGG - Intronic
1111179737 13:84648301-84648323 ATGTAGTTTTTTTGTTAACATGG + Intergenic
1111520393 13:89394697-89394719 ATGTAGTTGTATAATAAATAAGG - Intergenic
1111596969 13:90424403-90424425 TTCTATTTGTTTAATTATTATGG + Intergenic
1112791397 13:103006352-103006374 ATCTAGTTTTTTTTTTACCAGGG - Intergenic
1116195557 14:41721035-41721057 AAGTAGTTGTTTTATTAACCTGG + Intronic
1116546446 14:46171917-46171939 ATTTAATTTTTTAATTGACATGG - Intergenic
1118424502 14:65644817-65644839 ATATTGTTGATTTATTAACATGG + Intronic
1118424526 14:65645176-65645198 TTCTAGTTGGTAAATTCACATGG + Intronic
1120012762 14:79435958-79435980 ATCTAATTGTTTGATAAAAAGGG + Intronic
1121589489 14:95091871-95091893 ATCTAGTGGCTTAATGAAGAGGG - Intronic
1121986282 14:98509520-98509542 ATCTGGTGTTTTAATTAACAAGG + Intergenic
1131359357 15:91776335-91776357 ATCTTGTTTCTTAATTATCACGG + Intergenic
1135075552 16:19390383-19390405 ATCTAGGGGTTTACATAACAGGG - Intergenic
1135240498 16:20803005-20803027 AACTGGTTGTTTAATTAAAATGG - Intronic
1138041497 16:53674934-53674956 TTCAAGTTGTTTTTTTAACATGG - Intronic
1140510367 16:75503167-75503189 GTCTAGTTTTTTTATTAAAAAGG + Intergenic
1142943901 17:3408687-3408709 ATCATGTTGTTTAATTTCCATGG + Intergenic
1149321035 17:55481138-55481160 GTCTGGCTGTTTAATTAAAAGGG - Intergenic
1149914323 17:60594627-60594649 AGCTATTTGTTTAAATAACTTGG - Intergenic
1150731237 17:67696828-67696850 ATTTTGTTGTTAAATTAACAAGG + Intronic
1153008423 18:516175-516197 ATCAAGTTGTTTACTTCTCAAGG - Intergenic
1153152758 18:2113085-2113107 ATGTAATTGTTTAATGAAAATGG - Intergenic
1155284939 18:24278210-24278232 TTCTTGTTGTTTAAATGACAAGG - Intronic
1155630032 18:27882513-27882535 ATCTATTTGTTTAAGAGACAAGG + Intergenic
1157400966 18:47386948-47386970 ATTTAGGTGTTTAATCCACATGG + Intergenic
1158873481 18:61710908-61710930 ATCTAGTTTATCAATTAACTTGG + Intergenic
1159087617 18:63811614-63811636 ATATAGTTGTTTAATTTACAGGG + Intergenic
1159230547 18:65602627-65602649 ATCTAGTTATTCAATAAATAAGG - Intergenic
1162744978 19:12793060-12793082 ATATATTTGTGTATTTAACAGGG + Exonic
1164541888 19:29127657-29127679 ATCTAGTTTGTTAAATAAAACGG - Intergenic
1165441794 19:35832581-35832603 ATTTTGTTTTTTAATTAAGACGG + Intronic
1166931954 19:46306457-46306479 ACTTACTTTTTTAATTAACATGG + Intronic
927145184 2:20160356-20160378 ATTTAGTTCTTTAAGTAACCTGG + Intergenic
927560270 2:24066399-24066421 GTGTAGTTGTTTTAATAACAAGG - Intergenic
929854344 2:45623702-45623724 ATATCGTAGTTTAATTGACAGGG - Intergenic
930165637 2:48201232-48201254 GTCTAGTTGCTCAATTAAGATGG - Intergenic
930454109 2:51582939-51582961 ATCTAGAAATTTAATTAAAATGG - Intergenic
930538256 2:52671031-52671053 ATCTTGGGGTTTAATTCACAGGG + Intergenic
931265787 2:60659109-60659131 ACCTAGTTATTTAAATAAAATGG + Intergenic
932519591 2:72396335-72396357 AGCAAGTTCCTTAATTAACAAGG - Intronic
934687278 2:96330691-96330713 ATCTAGGTGATTAATTTTCATGG + Intergenic
934970036 2:98755770-98755792 ATTTAGTTTCTTAATTAACTTGG + Intergenic
936963044 2:118096934-118096956 ATCAAGTTGTTCAATTCAAACGG - Intronic
938752263 2:134343967-134343989 ACCTAGTTCTTTCATAAACAGGG + Intronic
938794044 2:134703697-134703719 ATTTACTTGTGTAAATAACAGGG - Intronic
940926009 2:159364344-159364366 TTCTAGTTGTTTCTTTATCAGGG + Intronic
940984817 2:160042421-160042443 ATCTACTTGTTTACTTACTATGG + Intronic
941063034 2:160869430-160869452 ATCTATTTGTCAAATAAACAGGG - Intergenic
941233930 2:162945377-162945399 ATCTCGTTGTTAAATTATCATGG - Intergenic
941379218 2:164771350-164771372 ATGTTGTTGTTTAAACAACAGGG + Intronic
943830241 2:192451822-192451844 ATCAACATGTTTAATTAATAGGG - Intergenic
943963692 2:194302419-194302441 ATTTTGTAGTTTAATTAACGAGG - Intergenic
945433287 2:209790903-209790925 ATGTCCTAGTTTAATTAACAGGG + Intronic
945767987 2:214003753-214003775 ATATAGTTGAATCATTAACATGG + Intronic
945800279 2:214420308-214420330 GTCTAGTTGTTTTTTTAATATGG + Intronic
945837445 2:214849675-214849697 ATCTATTTACTTAAATAACAGGG + Intergenic
947412988 2:229862560-229862582 AATGAGTTGTTTAATTATCAAGG - Intronic
1169591433 20:7147141-7147163 TTCTAGTGGTTTAATTAAGAAGG - Intergenic
1170011179 20:11725782-11725804 AAATATTTGCTTAATTAACATGG + Intergenic
1171168588 20:22994975-22994997 ATCCAGTTGTTAAACCAACATGG + Intergenic
1173547253 20:43908229-43908251 ATTTAATTGTTCAATTAACTTGG - Intergenic
1174025978 20:47575348-47575370 ACCTAGTTGTTTTTTCAACATGG - Intronic
1175506204 20:59486245-59486267 CTCTAGTTGATTCATTATCATGG + Intergenic
1175556475 20:59862478-59862500 ATTTACTTATTTAATTAACATGG + Intergenic
1176333023 21:5567322-5567344 AACTAGTTCTGTAACTAACATGG + Intergenic
1176394734 21:6253630-6253652 AACTAGTTCTGTAACTAACATGG - Intergenic
1176402879 21:6331257-6331279 TTCTAGTTGTTTTTTTAATATGG + Intergenic
1176434278 21:6657847-6657869 TTCTAGTTGTTTTTTTAATATGG - Intergenic
1176442423 21:6735474-6735496 AACTAGTTCTGTAACTAACATGG + Intergenic
1176458540 21:6984917-6984939 TTCTAGTTGTTTTTTTAATATGG - Intergenic
1176466685 21:7062544-7062566 AACTAGTTCTGTAACTAACATGG + Intronic
1176490246 21:7444322-7444344 AACTAGTTCTGTAACTAACATGG + Intergenic
1178693822 21:34775546-34775568 TTCTAGTTCATTGATTAACAAGG - Intergenic
1179057586 21:37950430-37950452 ATATTGTTGATTAATTAACATGG + Intergenic
1179114400 21:38476710-38476732 ATCTGGTTGTTTAGTCTACAAGG - Intronic
1183882755 22:40849169-40849191 TTCTAATTTTTTAAGTAACAGGG - Intronic
1185202271 22:49514812-49514834 AACTAGTTTTGTAATTAACTGGG - Intronic
949102099 3:157952-157974 GTTTAGTTTTTTAATTAACCAGG + Intergenic
951089649 3:18557351-18557373 GTCTAGATGGTTAATGAACATGG + Intergenic
951715351 3:25637501-25637523 ATATAGTAGTGTAATTAAAATGG + Intronic
951835902 3:26983180-26983202 ATGGAGTTGTTTAATCCACAAGG + Intergenic
953132450 3:40153280-40153302 ATCTCGTTGTTTTATGACCATGG - Intronic
956886678 3:73567184-73567206 ATCTGGTAGTTTGATCAACATGG + Intronic
956891409 3:73617705-73617727 ATCTATTTTTTTTTTTAACAGGG + Intronic
957379290 3:79404770-79404792 ATCTAGTTTTTTAATGGCCATGG - Intronic
957730009 3:84122394-84122416 ATCTAGTTGATCAATTAAAATGG + Intergenic
958027651 3:88067679-88067701 ATCCAATCGTTGAATTAACATGG + Intronic
958132824 3:89451041-89451063 AAATATTTGTTTAATTAACTGGG - Intronic
958533547 3:95365973-95365995 ATCTAGAGGTTTTATCAACAAGG + Intergenic
958753919 3:98227584-98227606 ATCTAGTTATAAAATAAACATGG - Intergenic
959293077 3:104499617-104499639 ATCTATTTGGAGAATTAACATGG + Intergenic
959503619 3:107134428-107134450 ATCTAGTAGTTTTAATTACATGG - Intergenic
960630206 3:119722647-119722669 ATATATTTTTTTAATTAGCATGG - Intronic
963364060 3:144311769-144311791 ATTTAGCTGTTTGACTAACAGGG - Intergenic
964152198 3:153540339-153540361 ATTAACTTGATTAATTAACATGG + Intergenic
965682109 3:171262225-171262247 ATCTGGTTGTTTTATTAAAAAGG - Intronic
966128069 3:176603555-176603577 AATTATTGGTTTAATTAACATGG + Intergenic
966148191 3:176835625-176835647 ATCTAGTTAGTTAATGAACAAGG - Intergenic
967079372 3:186035241-186035263 ATCTTCTTGTTTAAGTAACTTGG + Intergenic
969148669 4:5147299-5147321 AACTAATTATTTAATTAGCAAGG - Intronic
970190132 4:13508220-13508242 ATGTAATTGTTTAAATAAAATGG - Intergenic
971568257 4:28173563-28173585 ATCTAGGAGGTTAATAAACAAGG + Intergenic
972306608 4:37836644-37836666 ATCTGATTGTTTAACTCACAGGG + Intronic
973686481 4:53375784-53375806 ATTTAGTTGTTCAATCAAAATGG + Intergenic
974336788 4:60558258-60558280 ATCTATTTGTGAAAGTAACAAGG - Intergenic
974473215 4:62345705-62345727 TTCTAGTTGTTTACTTCAGAAGG + Intergenic
974645423 4:64684546-64684568 ATATACTTGTATAATAAACAAGG + Intergenic
974783825 4:66591474-66591496 AACTATTTGTATTATTAACATGG + Intergenic
977858506 4:101926474-101926496 ATCTATTTGTTAAACTAAAATGG - Intronic
979169147 4:117577622-117577644 ATCTAGCTCTTTATTTAAAAGGG + Intergenic
984002249 4:174263666-174263688 TTCTAGGTGTCTAATTTACAAGG - Intronic
984311112 4:178059985-178060007 AAATAGTAGTTTAATTAATAAGG - Intergenic
984536066 4:180977138-180977160 ATTTAGTATTTTAATTAAAAAGG - Intergenic
984538613 4:181008484-181008506 ATCTAGTTGGAATATTAACAGGG + Intergenic
986323653 5:6654849-6654871 ATCATGTTGTCTAAATAACATGG - Intronic
987555272 5:19438445-19438467 ATCAAATTGTTTCATTAAAAAGG - Intergenic
989676848 5:43982702-43982724 ATCTGGTTGTTTACTTTACTTGG - Intergenic
989881720 5:46797361-46797383 ATGTAGTTGTTCAATTCACAGGG + Intergenic
989882052 5:46804177-46804199 ATGTAGTTGTTCAATTCACAGGG + Intergenic
989882394 5:46810990-46811012 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989882621 5:46815424-46815446 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989882893 5:46820708-46820730 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989883106 5:46824967-46824989 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989883397 5:46830594-46830616 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989883699 5:46836565-46836587 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989883966 5:46841850-46841872 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989884229 5:46847134-46847156 ATGTAGTTGTTCAATTCACAGGG + Intergenic
989884493 5:46852415-46852437 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989884769 5:46857870-46857892 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989885031 5:46862983-46863005 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989885243 5:46867072-46867094 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989885522 5:46872527-46872549 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989885801 5:46877981-46878003 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989886078 5:46883437-46883459 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989886360 5:46888892-46888914 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989886582 5:46893323-46893345 ATGTAGTTGTTCAATTCACAGGG + Intergenic
989886796 5:46897411-46897433 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989887044 5:46902185-46902207 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989887325 5:46907640-46907662 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989887861 5:46918209-46918231 ATGTAGTTGTTGAATTCACAGGG + Intergenic
989888261 5:46926221-46926243 ATGTAGTTGTTCAATTCACAGGG + Intergenic
989888470 5:46930313-46930335 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989888751 5:46935768-46935790 ATGTAGTTGTTCAATTCACAGGG + Intergenic
989888969 5:46940026-46940048 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989889248 5:46945481-46945503 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989889655 5:46953660-46953682 ATGTAGTTGTTCAATTCACAGGG + Intergenic
989889789 5:46956219-46956241 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989890483 5:46970029-46970051 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989890694 5:46974119-46974141 ATGTAGTTGTTCAATTCACAGGG + Intergenic
989890970 5:46979576-46979598 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989891325 5:46986561-46986583 ATGTAGTTGTTCAATTCACAGGG + Intergenic
989891555 5:46991162-46991184 ATGTAGTTGTTCAATTCACAGGG + Intergenic
989891892 5:46997640-46997662 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989892168 5:47003096-47003118 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989892408 5:47007697-47007719 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989892692 5:47013152-47013174 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989893089 5:47021162-47021184 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989893369 5:47026619-47026641 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989893514 5:47029345-47029367 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989893800 5:47034552-47034574 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989894011 5:47038644-47038666 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989894232 5:47042905-47042927 ATGTAGTTGTTCAATTCACAGGG + Intergenic
989894509 5:47048358-47048380 ATGTAGTTGTTCAATTCACAGGG + Intergenic
989894781 5:47053642-47053664 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989894982 5:47057391-47057413 ATGTGGTTGTTCAATTCACAGGG + Intergenic
989895432 5:47066325-47066347 ATGTAGTTGTTCAATTCACAGGG - Intergenic
989895695 5:47076043-47076065 ATGTAGTTGTTCAATTCACAGGG - Intergenic
989895835 5:47078806-47078828 ATGTAGTTGTTCAATTCACAGGG - Intergenic
989897425 5:47109915-47109937 ATGTAGTTGTTCAATTCACAGGG + Intergenic
989897648 5:47114003-47114025 ATGTAGTTGTTCAATTCACAGGG + Intergenic
989897869 5:47118093-47118115 ATGTAGTTGTTCAATTCACAGGG + Intergenic
989897992 5:47120480-47120502 ATGTAGTTGTTCAATTCACAGGG + Intergenic
989898169 5:47123717-47123739 ATGTAGTTGTTCAATTCACAGGG + Intergenic
989898392 5:47127807-47127829 ATGTAGTTGTTCAATTCACAGGG + Intergenic
989898610 5:47131896-47131918 ATGTAGTTGTTCAATTCACAGGG + Intergenic
989898826 5:47135984-47136006 ATGTAGTTGTTCAATTCACAGGG + Intergenic
989899049 5:47140074-47140096 ATGTAGTTGTTCAATTCACAGGG + Intergenic
989899264 5:47143991-47144013 ATGTAGTTGTTCAATTCACAGGG + Intergenic
989899487 5:47148080-47148102 ATGTAGTTGTTCAATTCACAGGG + Intergenic
989899711 5:47152171-47152193 ATGTAGTTGTTCAATTCACAGGG + Intergenic
990675256 5:58177167-58177189 CCCTAGTTGTTTAATTTACATGG + Intergenic
990832606 5:59976429-59976451 ATCTAATTGTTTAAAGAATATGG + Intronic
993379099 5:87185600-87185622 ATCTAGTTGTAGATTTAATAAGG + Intergenic
996208752 5:120778532-120778554 ATCTAGTTGTCTATTCAAGACGG - Intergenic
997101262 5:130971572-130971594 AGCTGGTTGTTTAAATAACATGG - Intergenic
997422060 5:133777451-133777473 AACTACTTGTGTAATTAAGAAGG - Intergenic
998795773 5:145816999-145817021 AACAAATTTTTTAATTAACAAGG + Intronic
998886119 5:146695981-146696003 AAATAGTTTTTTGATTAACAAGG - Intronic
1000751608 5:165101784-165101806 ATTTAATTGCTTAATTCACAAGG + Intergenic
1004265493 6:14145281-14145303 ATCTTTTTGTTCAAATAACAAGG + Intergenic
1004687959 6:17965682-17965704 ATCCAGTGGCTTTATTAACAGGG + Intronic
1005472411 6:26174129-26174151 AGCTATTTATTTAAATAACATGG + Intergenic
1007170214 6:39857387-39857409 ATCCAGCTCTTTAAATAACAGGG + Intronic
1007963336 6:45981410-45981432 AGCTAGTTGTTTAATTTTCTTGG - Intronic
1008827157 6:55710166-55710188 ATCTCATTTTTTAATTAAAAAGG - Intergenic
1010041242 6:71387344-71387366 ATCTAGTTGCTTAATCACCAGGG + Intergenic
1011829293 6:91351792-91351814 ATATGTTTGTTTTATTAACAGGG + Intergenic
1013577538 6:111499581-111499603 ATCTACCTGCTTAATTAAGAGGG + Intergenic
1014508996 6:122297251-122297273 TTCTAGTTTTTTATTTAAAATGG + Intergenic
1016057845 6:139597410-139597432 ATCATTTTGTTTAATTAGCAGGG + Intergenic
1016671995 6:146719988-146720010 TTATAGTTGATTAAATAACAAGG + Intronic
1016818916 6:148329205-148329227 ACCTAGTTGTTTCATTTATAAGG + Intronic
1017588677 6:155954552-155954574 AACTAGTCATTCAATTAACAAGG + Intergenic
1018311111 6:162509896-162509918 AACTAGTTGTATAATTCACCAGG - Intronic
1019461813 7:1163360-1163382 GTCTAGTTGATTCATTAACATGG + Intergenic
1020781821 7:12526671-12526693 ATCTAGCTGTGTAATTGAAATGG + Intergenic
1020781825 7:12526750-12526772 ATCTAGCTGTGTAATTGAAATGG + Intergenic
1020781828 7:12526829-12526851 ATCTAGCTGTGTAATTGAAATGG + Intergenic
1020781855 7:12527303-12527325 ATCTAGCTGTGTAATTGAAATGG + Intergenic
1020781859 7:12527382-12527404 ATCTAGCTGTGTAATTGAAATGG + Intergenic
1020781862 7:12527461-12527483 ATCTAGCTGTGTAATTGAAATGG + Intergenic
1020781866 7:12527540-12527562 ATCTAGTTGTGTAATTGAAATGG + Intergenic
1020781870 7:12527619-12527641 ATCTAGCTGTGTAATTGAAATGG + Intergenic
1020781874 7:12527698-12527720 ATCTAGCTGTGTAATTGAAATGG + Intergenic
1020781877 7:12527777-12527799 ATCTAGCTGTGTAATTGAAATGG + Intergenic
1020781881 7:12527856-12527878 ATCTAGCTGTGTAATTGAAATGG + Intergenic
1020781884 7:12527934-12527956 ATCTAGCTGTGTAATTGAAATGG + Intergenic
1020781888 7:12528013-12528035 ATCTAGCTGTGTAATTGAAATGG + Intergenic
1020781892 7:12528092-12528114 ATCTAGCTGTGTAATTGAAATGG + Intergenic
1020781896 7:12528171-12528193 ATCTAGCTGTGTAATTGAAATGG + Intergenic
1020781900 7:12528250-12528272 ATCTAGCTGTGTAATTGAAATGG + Intergenic
1020781904 7:12528329-12528351 ATCTAGCTGTGTAATTGAAATGG + Intergenic
1020781908 7:12528408-12528430 ATCTAGCTGTGTAATTGAAATGG + Intergenic
1020781912 7:12528487-12528509 ATCTAGCTGTGTAATTGAAATGG + Intergenic
1021874954 7:25040048-25040070 AACTAGTTATTTCATTAGCAAGG + Intergenic
1022069112 7:26893448-26893470 ATTTAAGTGTTTAATAAACATGG + Intronic
1022763003 7:33377742-33377764 ATCTAGAAATATAATTAACAAGG - Intronic
1025163277 7:56685356-56685378 ATAAAATTGTTTAATTAACAAGG + Intergenic
1025226029 7:57164241-57164263 ATGAAATTGTTTAATTAATAAGG + Intergenic
1027370011 7:77498440-77498462 ATAGAGTTGCTTAAGTAACATGG - Intergenic
1029242248 7:99171595-99171617 AGCTAATTGTTTAATTAATTTGG - Intergenic
1030010772 7:105164655-105164677 ATCTAGTTTTTCTATGAACATGG + Intronic
1030048381 7:105517573-105517595 ATCTAGTATTTTAATGAAAAGGG - Intronic
1030181861 7:106717956-106717978 ATTTTGTTGGTTAATTACCATGG - Intergenic
1031348838 7:120703230-120703252 ATTTTGTTGTTAATTTAACAGGG - Intronic
1031795285 7:126166578-126166600 ATCTAGTTGTTTCCTAAAGAAGG + Intergenic
1032651866 7:133887589-133887611 ATTTAGTTCTCTAATAAACAAGG - Intronic
1033435474 7:141329750-141329772 TGATACTTGTTTAATTAACAGGG - Intronic
1033709111 7:143920620-143920642 AGCAAGTTGTTTAATTTCCAAGG + Intergenic
1035993128 8:4514642-4514664 GTCTACTTTTTTATTTAACAGGG - Intronic
1038448539 8:27622368-27622390 ATATATTTTTTTAATTAACTGGG - Intergenic
1039564804 8:38543649-38543671 ATATGGTTGTTTAAATAAGATGG + Intergenic
1039974888 8:42354395-42354417 ATCTTGCTGTTTCTTTAACAAGG + Intronic
1041864779 8:62559168-62559190 ATCTAGTTGTTTGATTATATTGG + Intronic
1042007105 8:64193399-64193421 ATCAAGTTGTTTAGTAAAAAAGG - Intergenic
1042383631 8:68148820-68148842 ATAAAGTTGTTTATTTAACGGGG + Intronic
1042771221 8:72384783-72384805 ATGTAGCTGTTTCCTTAACACGG - Intergenic
1042840027 8:73114425-73114447 ATCTATTTATTTATTTGACATGG + Intronic
1043231059 8:77801233-77801255 CTCTAGTTGTATAATATACAGGG - Intergenic
1043295600 8:78658884-78658906 ATCTGGTTGTTTTATTAATACGG + Intergenic
1043636738 8:82393596-82393618 ATCAAGTTGTGTAATTAGGATGG + Intergenic
1044173016 8:89080511-89080533 AACTATTTGTTTAATATACATGG - Intergenic
1044291564 8:90477400-90477422 AATTAGTTTTCTAATTAACATGG + Intergenic
1045144425 8:99324648-99324670 ATATAGCTGTTTAATTTAAAGGG + Intronic
1045161091 8:99545015-99545037 ATATAGTTGTTTCAATAAAAAGG - Intronic
1046633595 8:116646851-116646873 AACTAGTTATGTAAGTAACAGGG + Intronic
1048312158 8:133332221-133332243 ATTTATTTGTTGAATAAACAAGG + Intergenic
1048697899 8:137048923-137048945 ATTTAGTGGTTTTATTGACAGGG + Intergenic
1050668924 9:7974293-7974315 ATGTAATTGTGTACTTAACAAGG - Intergenic
1053654643 9:40204396-40204418 AACTAGTTGTTTAATTAACAAGG + Intergenic
1053905030 9:42833602-42833624 AACTAGTTGTTTAATTAACAAGG + Intergenic
1054366758 9:64350613-64350635 AACTAGTTGTTTAATTAACAAGG + Intergenic
1054529952 9:66171914-66171936 AACTAGTTGTTTAATTAACAAGG - Intergenic
1054674387 9:67840355-67840377 AACTAGTTGTTTAATTAACAAGG + Intergenic
1054972643 9:71106412-71106434 ATCTGGTTGTTTAAATATCCTGG + Intronic
1058046116 9:100358687-100358709 ATCTATTACTTTACTTAACAAGG - Intergenic
1059197841 9:112387550-112387572 ATTTAGTAGTTGAATAAACATGG + Intronic
1060478551 9:124002679-124002701 ATCTAGTTGTTTAAATCATCTGG - Intronic
1062251975 9:135602794-135602816 ATTAAAATGTTTAATTAACATGG + Intergenic
1203429062 Un_GL000195v1:72960-72982 AACTAGTTCTGTAACTAACATGG - Intergenic
1203405867 Un_KI270538v1:308-330 ATGTAGTTGTTCAATTCACAGGG + Intergenic
1186171567 X:6882740-6882762 ATCTAGTTGTGCAATTATCCAGG + Intergenic
1189205200 X:39232092-39232114 ATCTTGTTTTTTATTTAGCATGG - Intergenic
1190003547 X:46712396-46712418 ATCTGGTTGTTTAAAGAACCTGG - Intronic
1193779016 X:85680193-85680215 ATCAAGTTGTTTAATTTCCATGG + Intergenic
1193929068 X:87529912-87529934 TCCTAGTTGCCTAATTAACATGG - Intronic
1194226979 X:91273173-91273195 ATTTGATTGTTGAATTAACATGG - Intergenic
1194239720 X:91429798-91429820 AGCTAATTGTTTAATTAGCTGGG + Intergenic
1194530230 X:95038477-95038499 ATCTAGTTGCTTGATTATCTTGG + Intergenic
1195545375 X:106107061-106107083 ATCTGGTAGTTTCATTAAGAGGG + Intergenic
1196648305 X:118141792-118141814 GTCAAGTAGTTAAATTAACAGGG + Intergenic
1197124612 X:122929742-122929764 TTCTAGTTGTTTATTTAAAACGG + Intergenic
1197319745 X:125012859-125012881 ATCTAGTCGGTTGAGTAACAGGG + Intergenic
1197482392 X:127003803-127003825 TTCTAATTGTTGAATTAAAATGG - Intergenic
1199321562 X:146445506-146445528 AACTGGTTGTTTAAGAAACAAGG - Intergenic