ID: 1067862939

View in Genome Browser
Species Human (GRCh38)
Location 10:49872176-49872198
Sequence GGGGAGAAGAAAGATGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067862934_1067862939 -5 Left 1067862934 10:49872158-49872180 CCCAAGAAACGGGTGAAGGGGGA 0: 2
1: 0
2: 1
3: 8
4: 127
Right 1067862939 10:49872176-49872198 GGGGAGAAGAAAGATGGGGCAGG No data
1067862935_1067862939 -6 Left 1067862935 10:49872159-49872181 CCAAGAAACGGGTGAAGGGGGAG 0: 2
1: 0
2: 0
3: 4
4: 173
Right 1067862939 10:49872176-49872198 GGGGAGAAGAAAGATGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067862939 Original CRISPR GGGGAGAAGAAAGATGGGGC AGG Intronic
No off target data available for this crispr