ID: 1067865421

View in Genome Browser
Species Human (GRCh38)
Location 10:49900650-49900672
Sequence TTGGAGGCATAGGATAATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067865421_1067865427 23 Left 1067865421 10:49900650-49900672 CCCTCATTATCCTATGCCTCCAA 0: 1
1: 0
2: 0
3: 19
4: 207
Right 1067865427 10:49900696-49900718 ATGGTAAATGATTATTCCTTAGG No data
1067865421_1067865426 4 Left 1067865421 10:49900650-49900672 CCCTCATTATCCTATGCCTCCAA 0: 1
1: 0
2: 0
3: 19
4: 207
Right 1067865426 10:49900677-49900699 TTTACTTCTCAGTACTATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067865421 Original CRISPR TTGGAGGCATAGGATAATGA GGG (reversed) Intronic
900993576 1:6108758-6108780 TTGGAGGCATGGAAGAATTATGG + Intronic
903324950 1:22564148-22564170 TTGGAGGGACAGGAGAATGGGGG + Intronic
904264312 1:29309691-29309713 ATGGAGGCATAGAGAAATGAAGG + Intronic
905538154 1:38740000-38740022 TAGGAGTAATAGGATAATAAAGG + Intergenic
908261085 1:62339610-62339632 TAGGAGACATAGGATGAGGATGG + Intergenic
908503202 1:64765622-64765644 GTGGAGGAATGGGATAGTGAAGG + Intronic
910687150 1:89929074-89929096 TTGGATACATAGGACAAAGAAGG + Intronic
910874980 1:91870193-91870215 TTTGAGGAATAGCATAAAGATGG - Intronic
912162304 1:107000466-107000488 CTGGAGGCATCAGACAATGAGGG + Intergenic
915252311 1:154599428-154599450 ATGGAGGCAAAAGAGAATGACGG + Intronic
915847191 1:159278855-159278877 TAGAAGGTATAGGAGAATGATGG + Intergenic
916061184 1:161099484-161099506 TTGGAGTCATGGGAAAATTAAGG + Exonic
916710025 1:167396711-167396733 TTGAAGGAATAGGATAAGTAAGG + Intronic
918607927 1:186451945-186451967 ATGGAGGCATTAGATAAGGATGG - Intronic
919241513 1:194922259-194922281 TTAAAGGCATGGGATAATGGTGG + Intergenic
920495676 1:206453447-206453469 CTGGAGCCATAGGACTATGAGGG + Intronic
921356850 1:214292896-214292918 AAGGAGGCAGAGGATAAGGAAGG - Intronic
923872254 1:238008463-238008485 TTGGAGGGACAGGCTAATGGGGG + Intergenic
1065450302 10:25849494-25849516 CTGGAGGCATGGGGTAGTGAGGG + Intergenic
1066585862 10:36934645-36934667 TTGGAGACACAGGATTGTGAAGG - Intergenic
1067865421 10:49900650-49900672 TTGGAGGCATAGGATAATGAGGG - Intronic
1068239054 10:54280326-54280348 TTAGAGGCATAGGATAAAAAAGG - Intronic
1068299679 10:55122031-55122053 CTGGAGGAATAGGAAAAAGAAGG + Intronic
1069136915 10:64779254-64779276 TTGATGGCATAGGCTAAAGAGGG + Intergenic
1069425461 10:68284924-68284946 TTAGAGGCAGAGAAAAATGATGG - Intronic
1072466142 10:95664100-95664122 TAAGAGGCACAGGATAAGGATGG + Exonic
1073321768 10:102620045-102620067 TTGGAGGCAGAGGAGTAGGAAGG + Intronic
1073634899 10:105187618-105187640 TTGGAGGCAGAGGAAAAAGGAGG + Intronic
1074431171 10:113396055-113396077 TTGGGGGCATAGGATACAGAAGG + Intergenic
1075039045 10:119093101-119093123 TTGGCAGCAGAAGATAATGAAGG + Intergenic
1075879046 10:125834301-125834323 TTTAAGGCATAGGGAAATGAGGG + Intronic
1075918594 10:126190883-126190905 TGGGAGGCACAAGATAATGCTGG + Intronic
1077367049 11:2165491-2165513 TCGGAGGCCTGGGATAATGTGGG + Intronic
1077497508 11:2893337-2893359 TTGGAGGGAGAGGCTGATGATGG - Intronic
1079326007 11:19493205-19493227 TTGGAGGAGAAGGATAATGGGGG - Intronic
1079438852 11:20487528-20487550 TTAGAGGCATAGGTGCATGAGGG + Intronic
1079587425 11:22143014-22143036 ATGCAGGCATAAGATGATGAGGG - Intergenic
1079712587 11:23705091-23705113 GTGGAGGCATTTGATCATGAGGG - Intergenic
1082835601 11:57648396-57648418 CTGGAGGCAGAGGATAAGAAGGG + Exonic
1084303975 11:68269841-68269863 ATGAAGTCATAGGACAATGAAGG - Intronic
1084470273 11:69355478-69355500 TGGGAGGCACAGAATAAGGAGGG - Intronic
1086432091 11:86745672-86745694 GTGGAGACATAGGATAAAGGAGG + Intergenic
1086782351 11:90922936-90922958 TTGCAGGCATGGGCTAATGTTGG + Intergenic
1088591565 11:111408103-111408125 TTGGAGGCTTAGGACAGGGAAGG - Intronic
1088834437 11:113566223-113566245 TTGGAGACATAGGATAGAGATGG - Intergenic
1089085778 11:115815708-115815730 CTGGAGGCATGGGAGAAGGAGGG + Intergenic
1089170598 11:116508758-116508780 TTGGAAGCATGGGATGATGTAGG - Intergenic
1091035559 11:132229877-132229899 TTTTAGGCATAGAATAATGAGGG - Intronic
1091714629 12:2768085-2768107 TGGGAGGCAGAGAAGAATGAAGG + Intergenic
1092271126 12:7024147-7024169 TTGAAGGCATGGGATAATGGTGG + Intronic
1092597967 12:10028151-10028173 TTGGAGGCAGAGGAAAAGGCAGG - Intergenic
1094873946 12:34619829-34619851 TTGAGGGTATAGGGTAATGATGG + Intergenic
1095516005 12:43006169-43006191 TTGTAGGCATAGCATAATTATGG + Intergenic
1096499909 12:52058486-52058508 TTGGAGTATGAGGATAATGAGGG + Intronic
1098658932 12:73068557-73068579 TTGGTGGAATAGGTTCATGAGGG + Intergenic
1103210253 12:119160454-119160476 TTGGAAGCAGAAGGTAATGAGGG - Exonic
1105206209 13:18227154-18227176 TTGGAGGCACAGCATAATGGTGG + Intergenic
1115070063 14:29311082-29311104 TTGGAGGTAGAAGAGAATGAAGG - Intergenic
1115889182 14:38008070-38008092 TTGGAGGCATAGGACTGGGAAGG - Intronic
1116737414 14:48709677-48709699 CTGGAGGGATAGAATAAGGATGG + Intergenic
1118073456 14:62271415-62271437 TGGGAGGGGTAGGAGAATGAAGG - Intergenic
1118881059 14:69826286-69826308 TTAAGGGCATAGGATAATGGTGG - Intergenic
1119244469 14:73092032-73092054 TTGAAGTCATAGGATAAACATGG + Intronic
1125545704 15:40502791-40502813 GAGGAGGCATAGGAGGATGAAGG + Intergenic
1125827929 15:42691790-42691812 TGGAAGGCATTGGATAAGGAGGG - Exonic
1126311037 15:47316898-47316920 TTGGGGACAAAGGATAATGCTGG + Intronic
1129802310 15:78424437-78424459 TTGGGGACATTGGATACTGAAGG - Intergenic
1131886757 15:96924027-96924049 TTAGATCAATAGGATAATGACGG + Intergenic
1144040200 17:11403824-11403846 TTGGAGGCAGAGGGAAAAGAGGG + Intronic
1149308002 17:55367852-55367874 GTTTAGGCATAAGATAATGAGGG - Intergenic
1150004039 17:61458536-61458558 TTGAAGGAATAAGATGATGAAGG + Intronic
1151388286 17:73768840-73768862 TTTGAGGCAAAGTATTATGATGG + Intergenic
1153752107 18:8243226-8243248 TTGGAGACATAGGTTAATCCTGG - Intronic
1153879122 18:9405063-9405085 TTGGGGGCTTTGGACAATGAGGG - Intergenic
1154018346 18:10639645-10639667 TTGGAGGAACAGCATAATGGTGG - Intergenic
1154186527 18:12189945-12189967 TTGGAGGTACAGCATAATGGTGG + Intergenic
1154949663 18:21196815-21196837 CTGGAAGCATAGGATTGTGATGG - Intergenic
1156330754 18:36119687-36119709 TTGGAGTCCTAGGTTAAAGAGGG + Intronic
1157727411 18:49975458-49975480 TTGGAAGCATAGGACAATGCAGG - Intronic
1157988603 18:52468478-52468500 TTGGAGGCATGGGATGAGGTTGG - Intronic
1159246204 18:65808545-65808567 TTGGAAGCAGAGGATAAACATGG + Intronic
1164122471 19:22279383-22279405 TAGGAGGCATCGGATAATTTTGG + Intergenic
1166643353 19:44512968-44512990 CTAGAGGCACAGAATAATGAGGG - Intronic
1168094656 19:54107811-54107833 TTGGAGGCCTAGGATCAGGCAGG - Intronic
926938264 2:18108007-18108029 CTGGAGGCATAGGTTTTTGAGGG + Intronic
930262128 2:49160081-49160103 TTGAAGGTATAAAATAATGAGGG - Intergenic
930984938 2:57573954-57573976 GTGAAGGCACAGGATAGTGAGGG - Intergenic
932068387 2:68590911-68590933 TTGTAGGCATAGGAAGATGCCGG - Intronic
935737212 2:106115796-106115818 TTGGAGGTAGATAATAATGATGG - Intronic
939136216 2:138297615-138297637 TTTGGGGCATAGGAGAATGGAGG + Intergenic
939717838 2:145607475-145607497 ATGTAGGCAAAGAATAATGATGG + Intergenic
940225374 2:151395762-151395784 TTATAAGCATAGGGTAATGAAGG + Intergenic
940623561 2:156144756-156144778 TTTGAGGCCCAGGATAAAGAGGG - Intergenic
940798621 2:158107612-158107634 TTGGAGGCAGAGGAAAAGGAAGG + Intronic
944051571 2:195475844-195475866 TTGGAGGAAAAGAAAAATGAGGG + Intergenic
946779527 2:223178637-223178659 TTGGATCCATAAGATATTGAAGG + Intronic
947215003 2:227742278-227742300 TAAAAGGCATAGGAAAATGATGG + Intergenic
948001699 2:234573107-234573129 TTGCAGTCATAGGAAAATTATGG + Intergenic
1169746968 20:8952507-8952529 CTGGGGGAATAGGATAATGAGGG - Intronic
1169768680 20:9177492-9177514 TTGGGGGCAAAGTATAATCAAGG + Intronic
1169995362 20:11550191-11550213 TTGGAGGCATGGCAGAATGAGGG - Intergenic
1170224388 20:13975789-13975811 TTTGATGCATAGGACAATAAAGG + Intronic
1172420796 20:34815791-34815813 TTACTGGCATAGGAAAATGAGGG + Intronic
1173010723 20:39179229-39179251 TTGCAGGCAGAGGTTGATGATGG + Intergenic
1176685932 21:9848585-9848607 ATGGTGGCATAGGATATGGAAGG - Intergenic
1176886756 21:14265697-14265719 TGGGAGGGATTGGATCATGAGGG + Intergenic
1178339584 21:31774609-31774631 TAGGAGGCAAAGGAAACTGATGG + Intergenic
1178474622 21:32926667-32926689 TGGGAGGTATTGGATCATGAGGG - Intergenic
1179057073 21:37946114-37946136 TGGGAGGTATTGGATCATGAGGG + Intergenic
1179517314 21:41917659-41917681 TTGGAGGCACACGATAAAGGAGG - Intronic
1179623628 21:42634577-42634599 ATGGAGGAATAGGAGGATGATGG - Intergenic
1180759745 22:18191551-18191573 TTGGAGGTACAGCATAATGGTGG - Intergenic
1180770058 22:18375852-18375874 TTGGAGGTACAGCATAATGGTGG - Intergenic
1180775923 22:18433149-18433171 TTGGAGGTACAGCATAATGGTGG + Intergenic
1180776272 22:18486814-18486836 TTGGAGGTACAGCATAATGGTGG + Intergenic
1180808996 22:18744185-18744207 TTGGAGGTACAGCATAATGGTGG + Intergenic
1180827999 22:18878807-18878829 TTGGAGGTACAGCATAATGGTGG - Intergenic
1181071921 22:20349161-20349183 TTGGAGGTACAGCATAATGGTGG + Intergenic
1181194992 22:21178106-21178128 TTGGAGGTACAGCATAATGGTGG + Intergenic
1181214452 22:21314668-21314690 TTGGAGGTACAGCATAATGGTGG - Intergenic
1181382138 22:22514283-22514305 TTGGAGGCACAGCAGAAGGAGGG - Exonic
1181712830 22:24701596-24701618 TTGGAGGTAGAGCATAATGGTGG - Intergenic
1182638376 22:31747582-31747604 TTGGAGTCTTAGGATATTTATGG - Intronic
1183123274 22:35748999-35749021 CTGTAGGCCTAGGAAAATGAGGG - Intronic
1184061649 22:42086356-42086378 TTGAAGGCATATGACACTGAAGG + Intronic
1203231889 22_KI270731v1_random:117036-117058 TTGGAGGTACAGCATAATGGTGG - Intergenic
1203278097 22_KI270734v1_random:104806-104828 TTGGAGGTACAGCATAATGGTGG - Intergenic
951251948 3:20404233-20404255 CTGAAGGCATAGGATAAAGTGGG + Intergenic
952039881 3:29249175-29249197 TGGGAGGTATTGGATGATGAGGG + Intergenic
953899103 3:46829081-46829103 TGGGACCCATAGGGTAATGAGGG + Intergenic
955512940 3:59699553-59699575 TTAGAGGCTTTCGATAATGAGGG - Intergenic
957339910 3:78882666-78882688 CTGGAGGCAAAGGAGAAAGATGG - Intronic
962145192 3:132833256-132833278 TTGGGGGCAAAGAAAAATGAAGG + Intergenic
964017319 3:151963503-151963525 TTGGAAGCATGGAAAAATGATGG - Intergenic
965506679 3:169523226-169523248 CTGGAGGCAAAGGACAATAAAGG + Intronic
966265142 3:178031359-178031381 TTGGAGAGGTAGGATAAGGAAGG - Intergenic
966584740 3:181609565-181609587 TTGGAGGCATAAGAAAAGTATGG + Intergenic
966970937 3:185044832-185044854 TTTGAGGCATTGGAGAATGAGGG + Intronic
971052542 4:22877518-22877540 TAGGAGGCATATGAGAAGGAGGG - Intergenic
971498879 4:27297241-27297263 TTCCAGGCATAGGATCATGGAGG + Intergenic
974343098 4:60639612-60639634 TTGGAGGCACATGATAAAAAAGG - Intergenic
975099561 4:70497203-70497225 TTGGAGGTATAGGCAAATGGAGG - Intergenic
975383447 4:73728515-73728537 CTGGAGGCAGATGATGATGACGG + Intergenic
975470573 4:74761197-74761219 CTGGAGGCAAATGAAAATGAAGG + Intronic
975844432 4:78509989-78510011 TGGGAGGCTTTGGATAATGCAGG + Intronic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
978876194 4:113642808-113642830 TGGGAGGCTTTGGATCATGAAGG - Intronic
980217048 4:129866129-129866151 TAGGAGGTTTAGAATAATGAAGG - Intergenic
981237240 4:142433654-142433676 TTGGAGACATTACATAATGAAGG + Intronic
985529126 5:423656-423678 TTAAAGGCAAAGGATGATGAAGG + Intronic
987995848 5:25278546-25278568 TTGGACAAATAGAATAATGAGGG + Intergenic
988200353 5:28061288-28061310 CTGAAGGCATTGCATAATGAAGG - Intergenic
989492700 5:42076636-42076658 CTGGTGGCACAGGATCATGAGGG - Intergenic
990709972 5:58569709-58569731 TTGGAGGCGCAGGAAGATGAAGG - Intergenic
991481001 5:67079708-67079730 TTTGAGGCAGAGGAAAATGAAGG - Intronic
992208297 5:74452393-74452415 TTGGAGGTATTGGATCATGGAGG + Intergenic
993408365 5:87541713-87541735 TTTGAAGAATAGTATAATGAAGG + Intergenic
994836840 5:104865883-104865905 TTAAAGGTATAGGATAATGGTGG + Intergenic
995330500 5:110940567-110940589 TTGGTGGCATGGGCTTATGAGGG + Intergenic
995341793 5:111069383-111069405 CTGGAAGCCTAGGAAAATGAAGG + Intergenic
996036191 5:118762062-118762084 TTGGTGGCATGGGCTCATGAGGG - Intergenic
996174622 5:120340172-120340194 TGGTAGGCAAAAGATAATGATGG - Intergenic
996553596 5:124755097-124755119 ATGGAGGCAAAGGAGAAAGATGG - Intergenic
998133391 5:139662208-139662230 GTGGGGGCACTGGATAATGAGGG - Intronic
999412744 5:151366561-151366583 CAGGAGGCACAGGATGATGAGGG + Intergenic
999983379 5:156979172-156979194 CAGGAGCCATAGGATAAAGATGG - Intergenic
1001179429 5:169505422-169505444 TATAAGGCACAGGATAATGATGG - Intergenic
1002847627 6:961968-961990 GTGGAGGCATAGGAGAGGGATGG - Intergenic
1005947521 6:30605134-30605156 TTGCAGGTGTAGGATTATGAAGG - Intronic
1006197655 6:32255666-32255688 TTGGTGGCATGGGCTCATGAGGG + Intergenic
1007853467 6:44829129-44829151 TTGGAGGAACAGGAAAAGGAGGG + Exonic
1007889866 6:45278415-45278437 TTTGTGGAATAGGATAATGATGG - Intronic
1008166441 6:48144563-48144585 TTGGAGGTACACGAAAATGAAGG - Intergenic
1010580370 6:77589232-77589254 TAAGAGGCATAGGATTCTGATGG - Intergenic
1011050064 6:83136885-83136907 TAGGGGGCATACAATAATGACGG - Intronic
1012609297 6:101196109-101196131 TTGGTGGTATAGGATGTTGAAGG + Intergenic
1012736298 6:102949429-102949451 TGGGAGGCATTGGATCATGGGGG - Intergenic
1012975985 6:105781394-105781416 GTGGAGTCATAGGATGATGGAGG - Intergenic
1013064740 6:106672792-106672814 TTGAAGACTTAGAATAATGAAGG - Intergenic
1013698855 6:112738518-112738540 TTGGAGGTATTGGATCATGGGGG - Intergenic
1013841419 6:114399613-114399635 TTGGAGGAATAGCATAATTTTGG - Intergenic
1013851675 6:114523495-114523517 ATGGAAGCATAGAATTATGAAGG + Intergenic
1015270257 6:131330748-131330770 TTGCTGGAATAGCATAATGAGGG - Intergenic
1015798050 6:137032665-137032687 TTGGAGGCAAATGAGATTGACGG + Intronic
1015898089 6:138036243-138036265 CTGGAGGCCTAGGAGTATGACGG - Intergenic
1016657461 6:146538390-146538412 TTGGAGGAATAGAAAAAAGATGG + Intergenic
1017125029 6:151057302-151057324 TTGGAGGCAAAATATAATAATGG + Intronic
1018378404 6:163234744-163234766 TTGGAGGCAAAGTAAAATAAAGG + Intronic
1019099083 6:169612797-169612819 CTGGTGGCATAAGATTATGATGG - Intronic
1019946175 7:4331110-4331132 TTGAAGGCATAGGACATTGAAGG + Intergenic
1021131176 7:16914492-16914514 GGGGAGGCAGAGGATAAAGAGGG - Intergenic
1022359773 7:29646844-29646866 TTGGAGGTGGAGGAGAATGATGG - Intergenic
1022368575 7:29749501-29749523 TTGGAGGTGGAGGAGAATGATGG - Intergenic
1023032040 7:36098348-36098370 TGGGAGGAATAGGAAGATGAAGG + Intergenic
1023111012 7:36810571-36810593 TAGAAAGCATAGGAGAATGAAGG + Intergenic
1026358924 7:69584844-69584866 TTGCAGGCAGAGAACAATGAAGG + Intergenic
1026437922 7:70416234-70416256 TTGAAGGCATAGACTATTGAAGG - Intronic
1026733225 7:72929450-72929472 TTGGAGGTTTAGTAAAATGATGG + Intronic
1027110808 7:75438142-75438164 TTGGAGGTTTAGAAAAATGATGG - Intronic
1029919773 7:104250870-104250892 TTGGATGCAGAGGATGAAGATGG + Intergenic
1030279591 7:107758692-107758714 GTGGAGGCATAATATGATGAGGG - Exonic
1030471172 7:109964279-109964301 GTGTAGGAATAGGATAATGTGGG - Intergenic
1031297307 7:120017405-120017427 CTGGAGCCTCAGGATAATGAAGG + Intergenic
1032499411 7:132388846-132388868 TTTGAGGAATAGAATAATGAAGG - Intronic
1033978365 7:147130755-147130777 TTGGAGTCAATGCATAATGAGGG - Intronic
1037367543 8:18139291-18139313 GTGGAGGCAGAGGATAAGAAAGG - Intergenic
1041395375 8:57384777-57384799 TTCCAGGCACAGGGTAATGATGG - Intergenic
1042345176 8:67719676-67719698 ATGCAGGCATAAAATAATGACGG + Intronic
1043604542 8:81984354-81984376 TTGGAGGGATAGATTAAAGATGG - Intergenic
1043861711 8:85325118-85325140 TTGGATGCAGAGAATATTGATGG + Intergenic
1044459072 8:92423857-92423879 CTAGAGGAATAGGATAATGAAGG + Intergenic
1046305793 8:112365153-112365175 TGGGAGACATAGGAAAATTAAGG - Intronic
1047591501 8:126331818-126331840 TGGGAGGGATAGTATAAAGATGG + Intergenic
1047938684 8:129806680-129806702 TAGGAGGTATTGGATAATGAAGG + Intergenic
1048450712 8:134531204-134531226 TTGGAAGCATAGGGCAATGATGG + Intronic
1048753778 8:137711495-137711517 AGGGAGGCATACAATAATGAAGG - Intergenic
1050697520 9:8295481-8295503 ATCAAGCCATAGGATAATGAAGG + Intergenic
1057130394 9:92650633-92650655 TTGCAGGAAAAGGATAAAGATGG - Intronic
1057323373 9:94035312-94035334 TGGGAGGAATAGGAAGATGAAGG - Intronic
1057952650 9:99382151-99382173 TTTGAGGCAAAGGAAGATGAAGG - Intergenic
1194690186 X:96974725-96974747 TTGGGGGCATAGAATCATCAAGG + Intronic
1196537857 X:116868414-116868436 CTGGTGGCATGGGATCATGAGGG + Intergenic
1196680833 X:118467830-118467852 TTGGAGGGACTGGATAATCAAGG + Intergenic
1198316762 X:135475526-135475548 GTGGAGTCAGAGGATGATGATGG + Intergenic
1198607483 X:138357442-138357464 TTGGAGGTATAGGTAAAGGAGGG - Intergenic
1200256033 X:154584001-154584023 TTGGAGGTAGAGCAGAATGATGG - Intergenic
1200261736 X:154620402-154620424 TTGGAGGTAGAGCAGAATGATGG + Intergenic