ID: 1067869258

View in Genome Browser
Species Human (GRCh38)
Location 10:49942113-49942135
Sequence CCGCTGTTATTGAGGAGTAA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 2, 1: 0, 2: 0, 3: 2, 4: 50}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067869248_1067869258 23 Left 1067869248 10:49942067-49942089 CCCGGAATGTCAGCGTGTGAAGT 0: 1
1: 1
2: 0
3: 8
4: 91
Right 1067869258 10:49942113-49942135 CCGCTGTTATTGAGGAGTAACGG 0: 2
1: 0
2: 0
3: 2
4: 50
1067869247_1067869258 29 Left 1067869247 10:49942061-49942083 CCGGCGCCCGGAATGTCAGCGTG 0: 1
1: 1
2: 0
3: 3
4: 31
Right 1067869258 10:49942113-49942135 CCGCTGTTATTGAGGAGTAACGG 0: 2
1: 0
2: 0
3: 2
4: 50
1067869249_1067869258 22 Left 1067869249 10:49942068-49942090 CCGGAATGTCAGCGTGTGAAGTA 0: 1
1: 1
2: 0
3: 2
4: 85
Right 1067869258 10:49942113-49942135 CCGCTGTTATTGAGGAGTAACGG 0: 2
1: 0
2: 0
3: 2
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067869258 Original CRISPR CCGCTGTTATTGAGGAGTAA CGG Exonic
902915077 1:19633395-19633417 ACACTGTTATTGAGGAGAGAAGG + Intronic
903013420 1:20346208-20346230 GAGCTGTTTTTGAGGATTAAAGG - Intronic
903682992 1:25109526-25109548 CAGCGGTGATTGAGAAGTAACGG + Intergenic
903799240 1:25954324-25954346 TCTCTGTTATTGAGGTGTCATGG - Intergenic
907054490 1:51352417-51352439 TCACTGTTCTTGAGGATTAATGG - Intergenic
910474397 1:87591477-87591499 CAGCTATTATTGAGAAGGAAAGG - Intergenic
912666659 1:111587022-111587044 CCACTGGTGTTGAGGAGTCAAGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
1063197899 10:3760100-3760122 CCGATGTGACTGAGAAGTAAGGG + Intergenic
1066217581 10:33302622-33302644 CTGCTGTTAATGAGGAGGTAGGG + Intronic
1067400904 10:45972543-45972565 CCGCTGTTATTGAGGAGTAACGG + Exonic
1067869258 10:49942113-49942135 CCGCTGTTATTGAGGAGTAACGG + Exonic
1078670319 11:13358716-13358738 CGGCTGTTGCTGAAGAGTAAAGG - Intronic
1079958478 11:26893378-26893400 CTGCTCTTATTAAGGAGTTAAGG + Intergenic
1104358474 12:128109934-128109956 CTGCTGTGACTGAGGAGTGAGGG - Intergenic
1104399339 12:128462864-128462886 CTGCTGTTATTGGGGAGTTCTGG - Intronic
1104630164 12:130393866-130393888 CCGCTGATATTGGGGAGGATGGG - Intergenic
1111436099 13:88210239-88210261 CATCTGTTATTGAGGAGAGAAGG + Intergenic
1118702061 14:68443083-68443105 TCACTGTTATTGAGGAGGAAAGG - Intronic
1120211605 14:81639273-81639295 AAGTTGTTATTGGGGAGTAAAGG + Intergenic
1124868127 15:33514145-33514167 CCTCTGTGATTGAAGAGGAAAGG + Intronic
1131678750 15:94699744-94699766 CTGTTGTTTTTGGGGAGTAAAGG + Intergenic
1141013780 16:80428280-80428302 CACCTGTTATTGAGCATTAAAGG - Intergenic
1141355149 16:83338624-83338646 TAGCTGTTCTGGAGGAGTAAGGG + Intronic
1147009994 17:37437879-37437901 AAGCTGTTGTTGAAGAGTAAAGG + Intronic
1149455011 17:56780685-56780707 CCTCTGCTCTTGAGGAGTGACGG + Intergenic
1149881156 17:60292337-60292359 AATCTGTTGTTGAGGAGTAAAGG - Intronic
1151735541 17:75937902-75937924 TCACTGGTATTGAGGAGTCAGGG - Intronic
932887333 2:75560032-75560054 CCCCTACTATTGAGGGGTAAGGG - Intronic
936838498 2:116739744-116739766 AAGCTGTAATTGAAGAGTAATGG + Intergenic
942643667 2:178087855-178087877 CCACTGTGATTGAGGAGGAGTGG - Intronic
1173100534 20:40083915-40083937 CCACTGTCATAGAGCAGTAATGG + Intergenic
1180880719 22:19201819-19201841 CGGTTTTTATTGAGGAGGAAGGG - Intronic
1183677338 22:39306958-39306980 CCGCTGTTACTGAAGACTCACGG - Intergenic
1185084793 22:48734899-48734921 CCCCTGGTATTGCAGAGTAAAGG + Intronic
949219980 3:1620424-1620446 CCGCTATTCTAGAGGTGTAAGGG - Intergenic
952389413 3:32866822-32866844 CTGCTGTTGGAGAGGAGTAATGG + Intronic
961673754 3:128552549-128552571 CTGCTGTAATTGGGGAGTAGGGG - Intergenic
963464208 3:145658170-145658192 CCTCTGATATTAAGTAGTAAAGG - Intergenic
978971867 4:114817786-114817808 GTGCTATTACTGAGGAGTAATGG - Intergenic
985096326 4:186416334-186416356 CTCCTGTTTTTGAGGAGAAAAGG + Intergenic
992921838 5:81532003-81532025 CAGCTGTTATTGAGAGGAAATGG + Intronic
993447002 5:88025556-88025578 CCACTGGTATAGAGGAGGAACGG - Intergenic
1008859053 6:56127189-56127211 AAGCTGTAATTGAGGATTAAGGG - Intronic
1009746892 6:67827360-67827382 GAGCTGTTTTTGAGGAGTACAGG - Intergenic
1018412809 6:163571060-163571082 CCTCTGTCATTGAGTAGTTAAGG - Exonic
1018621812 6:165736027-165736049 ACGCTATTATTCAGGAGTAATGG + Intronic
1038387342 8:27161137-27161159 CTGCTCTGATTGAGGAGTAGGGG + Intergenic
1042059553 8:64802019-64802041 ACTCTGTTACTGAGGAGGAAGGG - Intergenic
1043047220 8:75341830-75341852 CAGCTTTTATAGAAGAGTAAAGG + Intergenic
1055647481 9:78374844-78374866 CTGCTCATATTGAGGAGGAAAGG - Intergenic
1058164619 9:101605868-101605890 CCGTTGTTATTGAGTACTGAGGG - Intronic
1058503603 9:105647366-105647388 CTGCTGGATTTGAGGAGTAAGGG + Intergenic
1198010380 X:132546637-132546659 CTGCTATTATTGAGAATTAAAGG + Intergenic