ID: 1067877747

View in Genome Browser
Species Human (GRCh38)
Location 10:50020078-50020100
Sequence CACAAACACAAGTGGAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067877747_1067877755 4 Left 1067877747 10:50020078-50020100 CCCTCACTCCACTTGTGTTTGTG No data
Right 1067877755 10:50020105-50020127 AAAGGACTGCCCGGGTCTCCAGG No data
1067877747_1067877758 11 Left 1067877747 10:50020078-50020100 CCCTCACTCCACTTGTGTTTGTG No data
Right 1067877758 10:50020112-50020134 TGCCCGGGTCTCCAGGAATGGGG No data
1067877747_1067877762 15 Left 1067877747 10:50020078-50020100 CCCTCACTCCACTTGTGTTTGTG No data
Right 1067877762 10:50020116-50020138 CGGGTCTCCAGGAATGGGGAGGG No data
1067877747_1067877752 -4 Left 1067877747 10:50020078-50020100 CCCTCACTCCACTTGTGTTTGTG No data
Right 1067877752 10:50020097-50020119 TGTGACCCAAAGGACTGCCCGGG No data
1067877747_1067877761 14 Left 1067877747 10:50020078-50020100 CCCTCACTCCACTTGTGTTTGTG No data
Right 1067877761 10:50020115-50020137 CCGGGTCTCCAGGAATGGGGAGG No data
1067877747_1067877756 9 Left 1067877747 10:50020078-50020100 CCCTCACTCCACTTGTGTTTGTG No data
Right 1067877756 10:50020110-50020132 ACTGCCCGGGTCTCCAGGAATGG No data
1067877747_1067877751 -5 Left 1067877747 10:50020078-50020100 CCCTCACTCCACTTGTGTTTGTG No data
Right 1067877751 10:50020096-50020118 TTGTGACCCAAAGGACTGCCCGG No data
1067877747_1067877757 10 Left 1067877747 10:50020078-50020100 CCCTCACTCCACTTGTGTTTGTG No data
Right 1067877757 10:50020111-50020133 CTGCCCGGGTCTCCAGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067877747 Original CRISPR CACAAACACAAGTGGAGTGA GGG (reversed) Intergenic
No off target data available for this crispr