ID: 1067877765

View in Genome Browser
Species Human (GRCh38)
Location 10:50020145-50020167
Sequence CACAAACACAAGTGGAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067877765_1067877769 -4 Left 1067877765 10:50020145-50020167 CCCTCACTCCACTTGTGTTTGTG No data
Right 1067877769 10:50020164-50020186 TGTGACCCAAAGGACTGCCCAGG No data
1067877765_1067877772 4 Left 1067877765 10:50020145-50020167 CCCTCACTCCACTTGTGTTTGTG No data
Right 1067877772 10:50020172-50020194 AAAGGACTGCCCAGGTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067877765 Original CRISPR CACAAACACAAGTGGAGTGA GGG (reversed) Intergenic
No off target data available for this crispr