ID: 1067877769

View in Genome Browser
Species Human (GRCh38)
Location 10:50020164-50020186
Sequence TGTGACCCAAAGGACTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067877765_1067877769 -4 Left 1067877765 10:50020145-50020167 CCCTCACTCCACTTGTGTTTGTG No data
Right 1067877769 10:50020164-50020186 TGTGACCCAAAGGACTGCCCAGG No data
1067877763_1067877769 18 Left 1067877763 10:50020123-50020145 CCAGGAATGGGGAGGGCAGCCAC No data
Right 1067877769 10:50020164-50020186 TGTGACCCAAAGGACTGCCCAGG No data
1067877766_1067877769 -5 Left 1067877766 10:50020146-50020168 CCTCACTCCACTTGTGTTTGTGA No data
Right 1067877769 10:50020164-50020186 TGTGACCCAAAGGACTGCCCAGG No data
1067877764_1067877769 -1 Left 1067877764 10:50020142-50020164 CCACCCTCACTCCACTTGTGTTT No data
Right 1067877769 10:50020164-50020186 TGTGACCCAAAGGACTGCCCAGG No data
1067877760_1067877769 26 Left 1067877760 10:50020115-50020137 CCGGGTCTCCAGGAATGGGGAGG No data
Right 1067877769 10:50020164-50020186 TGTGACCCAAAGGACTGCCCAGG No data
1067877759_1067877769 27 Left 1067877759 10:50020114-50020136 CCCGGGTCTCCAGGAATGGGGAG No data
Right 1067877769 10:50020164-50020186 TGTGACCCAAAGGACTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067877769 Original CRISPR TGTGACCCAAAGGACTGCCC AGG Intergenic
No off target data available for this crispr