ID: 1067877772

View in Genome Browser
Species Human (GRCh38)
Location 10:50020172-50020194
Sequence AAAGGACTGCCCAGGTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067877764_1067877772 7 Left 1067877764 10:50020142-50020164 CCACCCTCACTCCACTTGTGTTT No data
Right 1067877772 10:50020172-50020194 AAAGGACTGCCCAGGTCTCCAGG No data
1067877766_1067877772 3 Left 1067877766 10:50020146-50020168 CCTCACTCCACTTGTGTTTGTGA No data
Right 1067877772 10:50020172-50020194 AAAGGACTGCCCAGGTCTCCAGG No data
1067877763_1067877772 26 Left 1067877763 10:50020123-50020145 CCAGGAATGGGGAGGGCAGCCAC No data
Right 1067877772 10:50020172-50020194 AAAGGACTGCCCAGGTCTCCAGG No data
1067877767_1067877772 -4 Left 1067877767 10:50020153-50020175 CCACTTGTGTTTGTGACCCAAAG No data
Right 1067877772 10:50020172-50020194 AAAGGACTGCCCAGGTCTCCAGG No data
1067877765_1067877772 4 Left 1067877765 10:50020145-50020167 CCCTCACTCCACTTGTGTTTGTG No data
Right 1067877772 10:50020172-50020194 AAAGGACTGCCCAGGTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067877772 Original CRISPR AAAGGACTGCCCAGGTCTCC AGG Intergenic
No off target data available for this crispr