ID: 1067881920

View in Genome Browser
Species Human (GRCh38)
Location 10:50053224-50053246
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 4, 1: 1, 2: 2, 3: 7, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067881920 Original CRISPR GTCCCTGGCAACACGTGCTG TGG Intergenic
900724803 1:4208918-4208940 GTCCCTGGCCTCACCTGATGGGG + Intergenic
901154800 1:7128353-7128375 TTCCCTGGCCACCCGTGTTGGGG - Intronic
905447681 1:38037841-38037863 GTCCATGGCACCCCCTGCTGGGG - Intergenic
905482202 1:38269235-38269257 GGCCATGGCAACAAGAGCTGAGG + Intergenic
921102336 1:211940075-211940097 GCACCTGGGAACACGTGCTTAGG - Intergenic
1065852976 10:29806013-29806035 GTCCCTGGAAACAGGGGCAGGGG + Intergenic
1066450353 10:35522739-35522761 GACTCTGGCCACACATGCTGCGG + Intronic
1067284515 10:44897940-44897962 AACCCTGGCACCACGGGCTGTGG - Intergenic
1067374092 10:45711470-45711492 GTCCCTGGCAACACGTGCTGTGG + Intergenic
1067379594 10:45760792-45760814 GTCCCTGGCAACACGTGCTGTGG - Intronic
1067384093 10:45803167-45803189 GTCCCTGGCAACACGTGCCGTGG - Intergenic
1067880101 10:50035615-50035637 GCCCCTGGCAACAAGTGTGGTGG + Intergenic
1067881920 10:50053224-50053246 GTCCCTGGCAACACGTGCTGTGG + Intergenic
1067887292 10:50101449-50101471 GTCCCTGGCAACACGTGCTGTGG - Intronic
1067891781 10:50143737-50143759 GCCCCTGGCAACACGTGCCGTGG - Intergenic
1069559921 10:69422194-69422216 GGATGTGGCAACACGTGCTGTGG + Intergenic
1069658867 10:70110245-70110267 GTCCCTGGAAGCTGGTGCTGTGG + Intronic
1070853179 10:79584225-79584247 CTCCCAGGCCACACATGCTGAGG + Intergenic
1073938380 10:108662908-108662930 GTCTCAGGCAACAAGTGGTGCGG + Intergenic
1076217892 10:128710719-128710741 GTCCCTGGCGACCCTTGCTGGGG - Intergenic
1077264916 11:1643642-1643664 GTCTCTGGCAAGACGGGGTGGGG + Intergenic
1079643047 11:22830070-22830092 GTTCCAGGAAACACCTGCTGTGG + Intronic
1088489241 11:110370794-110370816 GTCTCTGTCAACCCATGCTGAGG - Intergenic
1088834652 11:113567679-113567701 GTCCCTGGCATCACATACTCAGG + Intergenic
1090819286 11:130326533-130326555 GTCCATGGCTCCACATGCTGGGG - Intergenic
1094407244 12:30129911-30129933 GTCCCTGGCAACAAGTGCAGTGG - Intergenic
1101945251 12:109131427-109131449 GTAAGTGGCAACAAGTGCTGGGG + Intronic
1104968478 12:132520547-132520569 GTCGCTGGTGTCACGTGCTGTGG + Intronic
1107975491 13:45684234-45684256 GTCACTGTTAACAGGTGCTGAGG - Intergenic
1108444857 13:50498070-50498092 GTCACTGGGAACACATGCTCTGG - Intronic
1121515325 14:94545764-94545786 TTCCATGGCAACGGGTGCTGTGG + Intergenic
1121561373 14:94878531-94878553 GTCCCAGGCCCCCCGTGCTGGGG + Intergenic
1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG + Intronic
1123923539 15:25087544-25087566 GCCCCTGGAAACACATGGTGTGG + Intergenic
1124570306 15:30856781-30856803 GTCCTTGGCCACACCGGCTGTGG - Intergenic
1125749980 15:42021468-42021490 GTCCCTGGCCACAGCTCCTGGGG - Intronic
1136032247 16:27511898-27511920 GTCCCTGGCAACACAAGCACGGG + Exonic
1136479574 16:30533205-30533227 GTCCCTGTCCACGCGGGCTGTGG - Intronic
1136483351 16:30556164-30556186 GTCCCTGTCCACGCGGGCTGTGG - Intronic
1136606254 16:31336070-31336092 GTCCCTGACATCACATGGTGCGG + Intergenic
1137671732 16:50283300-50283322 GGGCCTGGCAACACCTCCTGGGG - Intronic
1138347866 16:56331106-56331128 CCCCCTGGAAGCACGTGCTGTGG - Intronic
1138370023 16:56519628-56519650 TTGCCGGGCAACACGGGCTGGGG + Intronic
1138428288 16:56951093-56951115 GTCTCTGGCCCTACGTGCTGTGG - Intergenic
1141846252 16:86610976-86610998 GTTCCTGGCCACGGGTGCTGAGG - Intergenic
1142282196 16:89154470-89154492 GCCCCTGGCCCCACGTGCTGAGG + Exonic
1142354525 16:89596325-89596347 GTGCCGGGCAAGACTTGCTGAGG - Intronic
1143151492 17:4809728-4809750 GTTCCTGGCCTCACCTGCTGTGG + Exonic
1143303777 17:5930046-5930068 GTCCCGGGGAAAACCTGCTGGGG + Intronic
1144585169 17:16483297-16483319 GCCCCTGGCACCATGTGATGTGG + Intronic
1146141556 17:30372554-30372576 GTTCCTGCCATCACATGCTGGGG - Intergenic
1146676292 17:34775732-34775754 GTCCCTGCCAGGAGGTGCTGGGG - Intergenic
1146910914 17:36647888-36647910 CTCCCTGGCCACACCTGCAGGGG - Intergenic
1149231937 17:54544746-54544768 GTGCCTGGCAACCCCTGCTGAGG - Intergenic
1150614151 17:66755978-66756000 CTCCCTGGCTACTAGTGCTGGGG + Intronic
1152399393 17:80056285-80056307 TCCCTTAGCAACACGTGCTGCGG + Intronic
1153112190 18:1604836-1604858 TTCCCTCGCATCACGTGCTCTGG + Intergenic
1155532126 18:26777821-26777843 GTCCTTGCCAACTGGTGCTGTGG + Intergenic
1156492209 18:37502883-37502905 GTCCCAGGCACCCAGTGCTGGGG + Intronic
1161855219 19:6760729-6760751 GTCCCAGGCCACAGGGGCTGTGG - Exonic
1163007176 19:14404377-14404399 GGCCCAGGCATCACGTCCTGTGG - Exonic
1165156677 19:33792999-33793021 GTCCCTGGCACCACGCTCAGTGG - Intergenic
925377694 2:3400097-3400119 GTCCCTGTCAGCAGCTGCTGCGG + Intronic
926124706 2:10265043-10265065 GTTCCTGGCATCTCGTCCTGTGG + Intergenic
926272873 2:11379776-11379798 GTGCCTGCCAAAACATGCTGAGG + Intergenic
932735545 2:74251819-74251841 GGTCCTGCCAACACCTGCTGTGG + Intronic
934932335 2:98436718-98436740 GTCCCTGGCAGAAGGGGCTGTGG - Intergenic
935733379 2:106085054-106085076 GTCCCGGGGAACCCATGCTGGGG + Intergenic
936011611 2:108928655-108928677 GTCCCTGGCAGAATTTGCTGAGG + Intronic
937236266 2:120433433-120433455 GTCCTTGGCAACAGGGGCAGGGG - Intergenic
1175241542 20:57553252-57553274 GACCCTGACAAGACATGCTGAGG + Intergenic
1175714655 20:61247355-61247377 GTCCCAGGGAACAGGTGCAGAGG + Intergenic
1176263896 20:64198557-64198579 GCACCTGCCAACAAGTGCTGAGG - Intronic
1178616367 21:34136466-34136488 ATCCCTGCCAACACTTGGTGTGG + Intronic
1182295332 22:29308746-29308768 GTCCCTGGCACCTGGTGCTGGGG - Intronic
1183954577 22:41371771-41371793 CTCCTTGGAAACACATGCTGAGG + Intronic
1184420693 22:44381328-44381350 TGCCCTGGCAACAGGAGCTGAGG + Intergenic
1184807840 22:46807368-46807390 GACCCTGTCAGCCCGTGCTGAGG + Intronic
1185269867 22:49924519-49924541 ATCCCTGGCAGTACCTGCTGGGG - Intronic
1185299165 22:50070493-50070515 GTCCCTGGCACCCAGGGCTGAGG + Intronic
949626304 3:5870381-5870403 GTCAGTGGCAACAGGTGCTAAGG + Intergenic
950923223 3:16716017-16716039 GTCCCTGGAAACACTGTCTGGGG + Intergenic
952377710 3:32781084-32781106 GTCCCCGGCCAGCCGTGCTGGGG - Intergenic
954696579 3:52430535-52430557 GTCCCTGGCCACCTTTGCTGGGG - Intergenic
962494640 3:135926862-135926884 GTCACTGGCACCAGGTGGTGTGG - Intergenic
964410707 3:156394688-156394710 GTGCCTGGGGACATGTGCTGAGG - Intronic
968873612 4:3253946-3253968 GCCCACGGCAACACGTGATGAGG - Intronic
968899046 4:3422275-3422297 GGCCCAGGCCGCACGTGCTGGGG - Intronic
968963653 4:3758403-3758425 GTGCCTGGCCACAGGAGCTGAGG - Intergenic
970574524 4:17414325-17414347 GTCCATGGGACCAGGTGCTGCGG + Intergenic
972583092 4:40412559-40412581 GTCCATGGCAACCTATGCTGTGG + Intergenic
978866133 4:113513621-113513643 CATCCTGGCAACACATGCTGTGG - Intronic
984853112 4:184170729-184170751 GTACATGGCACCACGTGCAGTGG - Intronic
984904346 4:184612927-184612949 GGTCCTGACAACACGTGCTAAGG + Intergenic
985817061 5:2134914-2134936 GTCACTGTCAACATGTGATGGGG + Intergenic
985817067 5:2135004-2135026 GTCACTGTCAACATGTGATGGGG + Intergenic
993101062 5:83540392-83540414 GTCCCTGGAAAAACATCCTGAGG + Exonic
997092702 5:130876136-130876158 TTCCCTGGAAACACGTTGTGTGG + Intergenic
999841956 5:155437690-155437712 GTTCCAGGCAGCACATGCTGAGG - Intergenic
1007479839 6:42142576-42142598 GCACCGGGCAACAGGTGCTGCGG + Intronic
1016842653 6:148539888-148539910 GCCCTCAGCAACACGTGCTGAGG - Intronic
1018284042 6:162218138-162218160 GTCTCTGGGAGCACTTGCTGGGG + Intronic
1018456668 6:163959748-163959770 GTCCCTGCCAGCCCGAGCTGGGG - Intergenic
1019446001 7:1071690-1071712 TTCCCTGGCAATGCGTCCTGTGG - Intronic
1024590045 7:50873052-50873074 GTGCCTGGCAACCCCTGTTGTGG - Intergenic
1024705030 7:51947647-51947669 GGCCCTGGCAGCAGGTGATGGGG + Intergenic
1030187223 7:106776080-106776102 GACCCAGGCAACATGTGCTGTGG - Intergenic
1032019414 7:128398754-128398776 GTCCCTAGGAACACTTCCTGGGG - Intronic
1032474899 7:132204948-132204970 CTCCCTGGCAACGCGTGCCAGGG + Intronic
1034882639 7:154774172-154774194 GTCCCTGGGACCAGCTGCTGGGG - Intronic
1035946346 8:3967661-3967683 GTCCTTGTCAATACGTGCTGGGG + Intronic
1042892395 8:73627063-73627085 GTCCCTGGCAAGGCGATCTGGGG + Intronic
1048571733 8:135662482-135662504 TTCCCTTGCAACACCTGCTCTGG - Intergenic
1049124362 8:140773583-140773605 GTCAGTGTGAACACGTGCTGAGG + Intronic
1051132496 9:13877995-13878017 GTGCCTGCCAACATTTGCTGTGG - Intergenic
1052827763 9:33189418-33189440 GTCCCAGGCAACAAGTGATGAGG + Intergenic
1056548778 9:87634780-87634802 GTCCCTGACATCACGTGGGGAGG + Intronic
1056555533 9:87684324-87684346 GTGCCTGGCAGGCCGTGCTGGGG + Intronic
1060002202 9:119968854-119968876 GCCCCTGGCAGCCAGTGCTGTGG - Intergenic
1060479797 9:124011501-124011523 GGCCCTGGCAGCGCGTGCTCCGG - Intronic
1062133098 9:134910754-134910776 GTCTCTGGCTACACGATCTGGGG - Intronic
1186452145 X:9682930-9682952 GTTCCTGGCAACAGGTGGGGTGG - Intronic
1189883583 X:45516490-45516512 GTCTCTTGGAACACGTGCTCTGG + Intergenic
1201973558 Y:19821186-19821208 GACCCAGGCATCACGTTCTGAGG - Intergenic