ID: 1067883595

View in Genome Browser
Species Human (GRCh38)
Location 10:50068119-50068141
Sequence CTGGCGCCAGCTCCTGGTCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 162}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067883595_1067883611 27 Left 1067883595 10:50068119-50068141 CCCCGACCAGGAGCTGGCGCCAG 0: 1
1: 0
2: 2
3: 10
4: 162
Right 1067883611 10:50068169-50068191 GGTCGGTGGAGGAGATCCGCAGG 0: 2
1: 0
2: 0
3: 4
4: 97
1067883595_1067883604 6 Left 1067883595 10:50068119-50068141 CCCCGACCAGGAGCTGGCGCCAG 0: 1
1: 0
2: 2
3: 10
4: 162
Right 1067883604 10:50068148-50068170 AGCCCGTGTGGGAGCGGCCGTGG 0: 2
1: 0
2: 0
3: 10
4: 155
1067883595_1067883603 0 Left 1067883595 10:50068119-50068141 CCCCGACCAGGAGCTGGCGCCAG 0: 1
1: 0
2: 2
3: 10
4: 162
Right 1067883603 10:50068142-50068164 CGTCGGAGCCCGTGTGGGAGCGG 0: 2
1: 0
2: 0
3: 9
4: 82
1067883595_1067883600 -6 Left 1067883595 10:50068119-50068141 CCCCGACCAGGAGCTGGCGCCAG 0: 1
1: 0
2: 2
3: 10
4: 162
Right 1067883600 10:50068136-50068158 CGCCAGCGTCGGAGCCCGTGTGG 0: 1
1: 0
2: 2
3: 2
4: 62
1067883595_1067883609 16 Left 1067883595 10:50068119-50068141 CCCCGACCAGGAGCTGGCGCCAG 0: 1
1: 0
2: 2
3: 10
4: 162
Right 1067883609 10:50068158-50068180 GGAGCGGCCGTGGTCGGTGGAGG 0: 2
1: 0
2: 0
3: 14
4: 205
1067883595_1067883601 -5 Left 1067883595 10:50068119-50068141 CCCCGACCAGGAGCTGGCGCCAG 0: 1
1: 0
2: 2
3: 10
4: 162
Right 1067883601 10:50068137-50068159 GCCAGCGTCGGAGCCCGTGTGGG 0: 1
1: 1
2: 1
3: 2
4: 61
1067883595_1067883607 10 Left 1067883595 10:50068119-50068141 CCCCGACCAGGAGCTGGCGCCAG 0: 1
1: 0
2: 2
3: 10
4: 162
Right 1067883607 10:50068152-50068174 CGTGTGGGAGCGGCCGTGGTCGG 0: 2
1: 0
2: 0
3: 6
4: 115
1067883595_1067883608 13 Left 1067883595 10:50068119-50068141 CCCCGACCAGGAGCTGGCGCCAG 0: 1
1: 0
2: 2
3: 10
4: 162
Right 1067883608 10:50068155-50068177 GTGGGAGCGGCCGTGGTCGGTGG 0: 2
1: 0
2: 1
3: 9
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067883595 Original CRISPR CTGGCGCCAGCTCCTGGTCG GGG (reversed) Exonic
900196960 1:1381349-1381371 ATGGCGCCAGCTCCTGGCATGGG - Intergenic
900347247 1:2215610-2215632 CTGGGGCAAGCGGCTGGTCGGGG - Intergenic
900592872 1:3467692-3467714 CTGGCCCCAGCTCCAAGTCCCGG - Intronic
900736648 1:4303405-4303427 CTGCAGCCAGTTCCTGGCCGGGG + Intergenic
900792682 1:4690448-4690470 CTGGTGACAGCTCCTGGTTGTGG - Intronic
901448681 1:9323307-9323329 CTGGCCCCAGCCCCTTGGCGGGG + Intronic
901609984 1:10490362-10490384 CTGGCGAAAGCTCCAGGTCTAGG - Intronic
901647119 1:10722807-10722829 CTGGCGCCAGCTCTTCCTAGAGG - Intronic
901786072 1:11625881-11625903 CTGGCACCAGCTCCTCTTCCAGG - Intergenic
902378458 1:16041502-16041524 CTGGGCCCAGCTCCAGGTGGAGG - Intergenic
902385107 1:16071959-16071981 CTGGGGCCAGCTCCAGGTGGAGG - Intronic
902776091 1:18675948-18675970 TTGGAGCCAGCTCCTGGTGCAGG - Intronic
909267374 1:73577532-73577554 CTGGCTCCAGCTGCTGTTCCAGG - Intergenic
912451658 1:109770955-109770977 GTGCCGCCAGCTCCTGGAAGGGG - Intronic
913104134 1:115596002-115596024 CTGGCGCCACCTAGTGATCGAGG + Intergenic
913670454 1:121093388-121093410 CTGGTTCCAGCTACTGGTCATGG - Intronic
914022222 1:143880829-143880851 CTGGTTCCAGCTACTGGTCATGG - Intergenic
914660707 1:149788755-149788777 CTGGTTCCAGCTACTGGTCATGG - Intronic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
922025348 1:221743456-221743478 CTGGCCGCAGCTCCTGATCAGGG + Intergenic
923084573 1:230693920-230693942 CTGGCGCCGGCTCCTGCCAGAGG - Exonic
1062823159 10:549665-549687 CTGCCTCCAGCACCTGGTCGGGG - Intronic
1064458257 10:15508588-15508610 GTGGCTCCAGCTCCAGGTGGAGG - Intergenic
1067375892 10:45727431-45727453 CCGGCACCAGCTCCTGGTCGGGG - Exonic
1067883595 10:50068119-50068141 CTGGCGCCAGCTCCTGGTCGGGG - Exonic
1069942469 10:71964768-71964790 CTGGCGCGCGCGCCTGGACGCGG - Intronic
1070174195 10:73956507-73956529 CAGGGGCCAGCTCCTGGTGGAGG - Intergenic
1070816622 10:79328513-79328535 CTGTCTCCAGCTCCTGGTAATGG - Intergenic
1072189498 10:93068505-93068527 CTTGCGCCAGCTCCTGGCCGAGG - Exonic
1072539927 10:96390535-96390557 CTGGCGCCTGATCCTGGCCAGGG - Intronic
1072719549 10:97772070-97772092 CTGGCCCCAGCTCCAAGGCGGGG + Intergenic
1073292916 10:102422104-102422126 CTGCCGCCAGCTCAAGGACGAGG + Exonic
1075645018 10:124091762-124091784 CTGGGACCAGCTCCTGGGGGCGG - Intronic
1076631389 10:131854238-131854260 CTGGCGCCTCCGCCTGGCCGTGG - Intergenic
1077010258 11:376481-376503 CTGGGGGCCGCTCCTGGGCGGGG - Exonic
1077468540 11:2745808-2745830 CTGCCGCCTGCTCCTGGTCCTGG - Intronic
1078312248 11:10256472-10256494 CTGATGCCAGTTCCTGGTCCAGG + Intronic
1079116998 11:17646256-17646278 CTGGCCACAGCTCTTGGTGGAGG + Intronic
1080610757 11:33901725-33901747 ATGGCGCCAGCTCCAGGTTAGGG + Intergenic
1083893266 11:65607480-65607502 CTCGCGTCAGCTCCTCCTCGCGG + Exonic
1084426323 11:69086270-69086292 CTGGCCCCAGCTGATGGTCCTGG + Intronic
1084607974 11:70183685-70183707 CTGGTGCCAGCTGCTGGGCCAGG - Intronic
1085029821 11:73264370-73264392 CTGGGGACCGCTCCTGGTCTGGG - Intergenic
1085468985 11:76744746-76744768 CTGGTGCCAGGTCCTGGGCTGGG - Intergenic
1089065954 11:115662173-115662195 CTGGGGCCAGAGCCTGGTAGAGG - Intergenic
1089712491 11:120325554-120325576 CTGGCTCCGGCTCTTGGTCCGGG + Intronic
1090991138 11:131817891-131817913 CTGGTGCCAGCTCCTGTTCCTGG + Intronic
1100260493 12:92928798-92928820 CTGGCGCCCGCTCCGGCGCGGGG - Intronic
1104802670 12:131565399-131565421 CTGGCCCCAGCGCCTGTCCGGGG + Intergenic
1105426162 13:20296739-20296761 CTGTCCCTAGCTCCTGGTGGTGG + Intergenic
1113561663 13:111286482-111286504 CCGGCCCCAGCTCCTGGATGAGG - Intronic
1119392847 14:74302875-74302897 CTGGCGCCAGCTCCGGGCGCGGG + Exonic
1122409111 14:101517085-101517107 CTGGAGCCAGCACCTGGGAGGGG - Intergenic
1124232737 15:27959622-27959644 CTGGTGCCAGCCCCTGGGTGCGG + Intronic
1125720370 15:41842374-41842396 CTGGCCCCAGCACCTGCTCAGGG - Intronic
1128115534 15:65102537-65102559 CAGGCGCCAGCCCATGTTCGGGG + Exonic
1128837793 15:70825248-70825270 CTGGCACCTGCTCCTAGTTGAGG - Intergenic
1129273860 15:74433195-74433217 CTGGCCCGAGCTCCGGGCCGGGG + Intronic
1129483004 15:75843054-75843076 CTAGCGCCAGCCCCTGGGGGCGG - Intergenic
1129782510 15:78282403-78282425 CAGATGCCAGCTCCTGGTAGAGG - Intronic
1131257328 15:90871413-90871435 CTGCCTCCGGCTCCTGGTAGGGG - Intronic
1132796562 16:1726714-1726736 CTGGCCCCAACTCCTGGTGCTGG - Intronic
1132882228 16:2167523-2167545 CTGGGGCCACTTCCTGGTCCTGG + Intronic
1132896913 16:2233555-2233577 CTGGAGCCAGCTCCTGCTGCCGG + Exonic
1133046597 16:3091769-3091791 CAGCCGCCAGCTCCTGATCTCGG + Exonic
1133315956 16:4884220-4884242 CCGGCGGCAGCTCCTGGAGGGGG - Exonic
1134098619 16:11436063-11436085 CTGGCTCCAGCTCCTGGCCCAGG + Intronic
1134121325 16:11586805-11586827 GTGGCGCCAGCACCTGCTGGGGG - Intronic
1136226532 16:28863992-28864014 CGGGCGCCAGGGCCGGGTCGCGG - Intronic
1137389653 16:48070739-48070761 CTGGCTCCAGCTTCTGGATGAGG - Intergenic
1137565551 16:49530524-49530546 CTGGTGCCAGATCCTGTTCTAGG - Intronic
1138335778 16:56251852-56251874 CTGGAGCCAGCTCTTGATCAGGG - Intronic
1141994915 16:87630239-87630261 CTGGGGCCAGCTGCTGTTCTTGG + Intronic
1142717628 17:1755632-1755654 CGGGCACCAGCTCCTGGCAGAGG - Intergenic
1143622975 17:8091533-8091555 CTGGCTCCCGCCCCTGGTCCAGG - Intergenic
1143755488 17:9064272-9064294 CTGGGGCGAGCTCCTGGATGTGG - Intronic
1145881831 17:28357718-28357740 CTGGCTCCAGCTCCCCGCCGGGG - Exonic
1147742098 17:42675544-42675566 CCGGCGCCAGCACCTGGCGGAGG - Intronic
1148682990 17:49485394-49485416 CAGGTGCCAGCTGCTGGTCCGGG + Intergenic
1151627227 17:75284527-75284549 CTGGCGGCGGCACCTGGTGGCGG + Intronic
1151821462 17:76499313-76499335 GTGGCCCCAGCTCCTGGGCATGG + Intronic
1152190734 17:78885811-78885833 CTCTCACCAGCTCCTGGTGGAGG + Intronic
1152378134 17:79929097-79929119 CTGGCCCCAGCTCCCAGTGGAGG - Intergenic
1161774809 19:6254537-6254559 CTTGCGCTAACTCCAGGTCGTGG + Intronic
1162601505 19:11673682-11673704 GTGGCGCCATCTCCTGGCCTTGG - Intergenic
1163745001 19:19041129-19041151 CTGGCCCCAGCTCCTTTTCGTGG + Intronic
1164411206 19:28007135-28007157 ATGGGGCCAGCTCCTAGTCAAGG + Intergenic
1165689918 19:37855364-37855386 CTCGCGGAAGCTCCTGGGCGGGG - Intergenic
1166666623 19:44684073-44684095 CTGCTGCCAGCTGCTGGTCTTGG + Exonic
1167587290 19:50382348-50382370 CTGGCTCCCACGCCTGGTCGGGG + Intronic
925279438 2:2672401-2672423 CTGTCCCCAGGTCCTGGCCGTGG + Intergenic
927554003 2:24020055-24020077 CTAGCACCAGGTCCTGGACGTGG - Intronic
933707187 2:85300513-85300535 CTGGCGCCACCTGGTGGTCATGG + Intronic
933807599 2:86011670-86011692 ATGGCACCAGCTCCTGGGCAGGG + Intergenic
935627261 2:105181405-105181427 CAGAGGCCAGCTCCTGGCCGAGG - Intergenic
937244421 2:120483465-120483487 CTGGTGCCAGCCCCTGGCCCAGG + Intergenic
938246443 2:129781018-129781040 CAGGAGCCAGCTGCTGGTCCAGG - Intergenic
941705016 2:168649299-168649321 CTGGCATCAGCCCCAGGTCGTGG + Intronic
945921228 2:215756521-215756543 CTGGCAGCTGCTCCTGGTGGGGG - Intergenic
947796962 2:232900859-232900881 CTGGCTTCAGGTCCTGGTCCTGG - Intronic
948597134 2:239087399-239087421 TTGGCTCCAGCTCCTGGGTGTGG - Intronic
949077795 2:242072184-242072206 ATTCCGCCAGCTCCTGGGCGGGG - Intergenic
1169039394 20:2480571-2480593 ATGGTGCCAGCACCTGGTGGGGG - Intronic
1171990675 20:31694132-31694154 CAGGTGCCAGTTCCTGGGCGTGG - Intronic
1173689373 20:44948210-44948232 CTGACGGCAGCTCCTGGTGCAGG + Intronic
1174500672 20:50981634-50981656 CTGGCGCCCCCTCCTGGTAATGG - Intergenic
1176013280 20:62912183-62912205 CTGGCCCCAGCCCCTGGTTGGGG - Intronic
1181551305 22:23640375-23640397 CTGGCGCCAGATGCTGGCCCTGG - Intergenic
1182442444 22:30372274-30372296 CTGGCCTCACCTCCTGGTGGCGG - Exonic
1183675229 22:39295325-39295347 GAGGCGCCAGCTCCTGGGCCTGG - Intergenic
1184503192 22:44886057-44886079 GCGGCCCCAGCTCCTGGTCACGG - Intronic
1185322736 22:50209378-50209400 CTGGCGCCAGCTTCTGCTGACGG - Intronic
950473986 3:13204264-13204286 CGGGCGCCAGCGCCAGGACGGGG + Intergenic
954786546 3:53097296-53097318 CTGGCCCCAGCGCCTGGCCCTGG - Intronic
954886759 3:53881859-53881881 CAGGCCCCAGCCCCTGGTGGGGG - Intronic
959134585 3:102400912-102400934 CTGTGGTCAGCTCCTGGTCTGGG - Intronic
960724147 3:120653444-120653466 CTGGCTGCAGCACCTGGTCAAGG + Intronic
962279331 3:134038521-134038543 CTGGGTCCAGCCCCTGGTCTGGG + Intronic
963110354 3:141683142-141683164 CAGGCTCCAGCTCCTGGGAGGGG + Intergenic
963123780 3:141797236-141797258 CTGCCGCCACTTCCTGGGCGGGG - Intronic
968549910 4:1216831-1216853 CTGGGGCCGGCTCCTCCTCGGGG + Intronic
968574786 4:1360559-1360581 CAGGCGCCAGCCTCTGGGCGCGG - Intronic
968585435 4:1414197-1414219 CTGGCGCCACCGCCTGCTTGGGG + Intergenic
968752062 4:2395464-2395486 CAGGCACCAGGTCCAGGTCGTGG + Intronic
970518971 4:16863545-16863567 CTGGCTCCAGCTCCTTGCAGAGG - Intronic
971757310 4:30720806-30720828 CTGGCCCCAGCGCCTGGTGCAGG + Exonic
972587903 4:40455306-40455328 CTGGCTCCAGAGCCTGGGCGTGG - Intronic
981285229 4:143009827-143009849 CTGGCACCTGCTCCTGGTGAGGG + Intergenic
987123334 5:14788400-14788422 CTGGCACCATCTCTTGGTTGAGG + Intronic
989638003 5:43556806-43556828 CGGGCCCCAGGTGCTGGTCGGGG - Exonic
998449472 5:142223020-142223042 CCAGCGCCTGCTCCTGGTCTTGG + Intergenic
999439449 5:151590280-151590302 CAGGCGCCAGCTCCAGATTGAGG + Intergenic
1001536902 5:172504384-172504406 CTGGCTCCAGCCCCTGCTCTAGG - Intergenic
1002559393 5:180071471-180071493 GCGGCGCCAGCACCTGGCCGCGG + Exonic
1002947944 6:1780617-1780639 CGGGAGCCAGCTCCTGGGCCTGG - Intronic
1005968631 6:30744172-30744194 CCGGCGCCAGCTGCCAGTCGAGG - Exonic
1006466219 6:34196404-34196426 CTGGCGCCCCCTCGCGGTCGTGG - Intergenic
1006912176 6:37570547-37570569 CTGGGGCCAGCTCCGGGCCTTGG + Intergenic
1009479896 6:64143655-64143677 CTGTCCCCAGCTCCTGGGCATGG + Intronic
1010204545 6:73310427-73310449 CTGGCTCCAGCCCCAGGTGGCGG - Intergenic
1013013216 6:106138254-106138276 CTGGTGCCAGCCCATGGTCTAGG - Intergenic
1016538643 6:145137974-145137996 CTGGGTCCAACTCCTGGTTGGGG - Intergenic
1018860281 6:167706438-167706460 CTGGCGCCTGCTCACCGTCGAGG + Intergenic
1019541738 7:1554708-1554730 CTGGGGACTGCTCCGGGTCGGGG + Intronic
1019624999 7:2011492-2011514 GTGCCGCCAGCTCCTGGGCTGGG - Intronic
1020173519 7:5864216-5864238 GTGGTCCCAGCTCCTGGTTGGGG + Intergenic
1023881705 7:44324860-44324882 CTTGCGCCTGCTCCTGCGCGTGG - Intronic
1023966792 7:44967032-44967054 CAGGTTCCAGCCCCTGGTCGGGG + Intronic
1024919401 7:54542242-54542264 CCGGCGCGAGCTCCCGGGCGGGG + Intergenic
1026817159 7:73521996-73522018 CTGGCGCTCGCTCCGGGCCGCGG - Exonic
1026922977 7:74170018-74170040 CTGGCCCCAGCTGCTGGCTGGGG + Intergenic
1028709329 7:93890206-93890228 CTGCCGCCAGTTCCTGTACGGGG - Exonic
1029168706 7:98616592-98616614 CCGGCGCCTGGTCCTGGTCCCGG + Intergenic
1033283039 7:140019150-140019172 CTGGGACCAGCTGCTGGTCCTGG + Intronic
1033628241 7:143132122-143132144 CTTGCTCCAGCTCCTGTTCAGGG + Exonic
1034819620 7:154204649-154204671 CTTGCGGCAGGTCCTGGGCGTGG + Intronic
1036817322 8:11911958-11911980 TTGGCGCCACCTCCTGGCCCTGG - Intergenic
1037859211 8:22392799-22392821 CTGGCTCCAGCGCCTGGGCCTGG + Intronic
1039607947 8:38898509-38898531 CTGGGGCCAGGTCCTGGCCAGGG + Intergenic
1039859008 8:41440384-41440406 CTGGCATCTGCTCCTGGTTGAGG + Intergenic
1041539269 8:58964477-58964499 CTGGAACCAGCTCCTGGTCAGGG - Intronic
1048467820 8:134682126-134682148 CTGGTGCCAGCTCATGGTGAGGG - Intronic
1048979035 8:139693263-139693285 CTGGCGCCAGCAGCTGGCCTTGG + Intronic
1049469673 8:142769719-142769741 CTGGGGCCACCTCCTGCTCAAGG - Intronic
1049542958 8:143216657-143216679 CTGGCACCAGCTACTGGTGAAGG - Intergenic
1049766274 8:144356683-144356705 CTGCCCCCAGCTCCAGGTCCTGG - Exonic
1057435960 9:95040693-95040715 CTGGCCCAAGCTCCTGGAGGTGG + Intronic
1060599601 9:124869207-124869229 CTCGCACCGGCTCCTGCTCGGGG - Exonic
1060945757 9:127568734-127568756 CCGGCGCCAACTGCTGGCCGGGG + Intronic
1061754044 9:132800263-132800285 CTGGCGCCAGGTCCTGGCACTGG - Intronic
1062555015 9:137109962-137109984 CTGGCGCCTGCCCCTTGTCACGG + Intergenic
1190597272 X:52062239-52062261 CTGGCGCCAGCTTCTTCTCCTGG - Exonic
1190611552 X:52191834-52191856 CTGGCGCCAGCTTCTTCTCCTGG + Exonic
1196857839 X:120000343-120000365 CAGGGGCGAGCTCCTGGTCAGGG + Intergenic
1197772821 X:130100285-130100307 CTGGCGCCAACTCCTACTCCAGG + Intronic