ID: 1067887292

View in Genome Browser
Species Human (GRCh38)
Location 10:50101449-50101471
Sequence GTCCCTGGCAACACGTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067887292 Original CRISPR GTCCCTGGCAACACGTGCTG TGG (reversed) Intronic