ID: 1067894640

View in Genome Browser
Species Human (GRCh38)
Location 10:50165773-50165795
Sequence CAGAACAAGGACAAGAATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067894638_1067894640 1 Left 1067894638 10:50165749-50165771 CCAAGCTTATCAGATGATTTTTG No data
Right 1067894640 10:50165773-50165795 CAGAACAAGGACAAGAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067894640 Original CRISPR CAGAACAAGGACAAGAATTC AGG Intergenic
No off target data available for this crispr