ID: 1067901722

View in Genome Browser
Species Human (GRCh38)
Location 10:50248607-50248629
Sequence CTGCTGTACCTGAGAAGAAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067901722_1067901724 3 Left 1067901722 10:50248607-50248629 CCATTTCTTCTCAGGTACAGCAG 0: 1
1: 0
2: 1
3: 13
4: 217
Right 1067901724 10:50248633-50248655 TGGAAGAAGAAATACTGAAGAGG 0: 1
1: 0
2: 2
3: 49
4: 568

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067901722 Original CRISPR CTGCTGTACCTGAGAAGAAA TGG (reversed) Exonic
901567816 1:10133164-10133186 CTGCTTTGCCAGAGGAGAAAAGG + Intronic
901624113 1:10613909-10613931 CTTCTCTAGCTGGGAAGAAAAGG - Intronic
902762692 1:18593871-18593893 ATGATGCATCTGAGAAGAAATGG - Intergenic
906584130 1:46961552-46961574 CTGCTCTTCCTGAGAACAAAGGG + Intergenic
909336507 1:74480854-74480876 CTGCTCTCCCTAAGCAGAAATGG - Exonic
910251050 1:85200377-85200399 CTGCTGTCCCTGGGAATGAAGGG - Exonic
911068253 1:93811313-93811335 ATGCTGTAGCAGGGAAGAAAGGG + Intronic
911391219 1:97246383-97246405 CTGCTGAAACTTAGAAGACAAGG + Intronic
911695490 1:100886412-100886434 CTGATTTACCTGTTAAGAAATGG - Intronic
911702096 1:100965755-100965777 CTGCTGTACCTGAAATATAAAGG - Exonic
912961966 1:114204039-114204061 CTGCTGTGCCTGAGCAGGCAAGG - Intergenic
913478625 1:119263138-119263160 CTTCAGATCCTGAGAAGAAAAGG + Intergenic
914950892 1:152112552-152112574 CTGCTGGAGCTGAGGAGGAAGGG - Exonic
916837781 1:168566319-168566341 CTGCTCTACCAGAAAAAAAATGG + Intergenic
917019538 1:170570699-170570721 TTGGTGTACCTGAAAGGAAAGGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
920648216 1:207818473-207818495 CTGTTTCACCTAAGAAGAAAAGG + Intergenic
924003216 1:239576811-239576833 CTGCGGTAGCTGTGCAGAAATGG - Intronic
1064327307 10:14363376-14363398 CTGTAGTACCTAAGTAGAAAAGG - Intronic
1067073561 10:43157242-43157264 CAGCTCTACCTAAAAAGAAAGGG + Intronic
1067575963 10:47408884-47408906 CTTCTGTTCCTGGGAACAAAAGG + Intergenic
1067751450 10:48974417-48974439 TTGCTGTACCTGGGAAGCAAAGG + Intronic
1067901722 10:50248607-50248629 CTGCTGTACCTGAGAAGAAATGG - Exonic
1067956185 10:50794294-50794316 CAGTTGTACCTGCTAAGAAAGGG + Intronic
1068131447 10:52900554-52900576 GTGCCGTAGCTGAGGAGAAAGGG + Intergenic
1069074329 10:64022071-64022093 CTCCTTTATCTGAGGAGAAATGG - Intergenic
1069357126 10:67598995-67599017 CTGTTGTTCCTGAAATGAAATGG - Intronic
1070025064 10:72624630-72624652 CTTGTGTGCCTGAGGAGAAAGGG - Intronic
1071151115 10:82635742-82635764 CTGCATTATTTGAGAAGAAAAGG - Intronic
1072370046 10:94757044-94757066 CTGCTGTACCTGAAAGGGACGGG - Intronic
1072458354 10:95596956-95596978 CTGCCCTGCCTAAGAAGAAAAGG - Intergenic
1073507863 10:104016971-104016993 CTGCTGTAACTGCCAAGAGAGGG + Intronic
1074172697 10:110958898-110958920 CTGATGTACTTGAGAACAATTGG - Intronic
1078893323 11:15576990-15577012 CTGCTGTTCCTGAGATGCAATGG - Intergenic
1079272978 11:19005898-19005920 CTGCTGGAGCTGTGAAAAAAGGG + Intergenic
1081460517 11:43268558-43268580 TTGCTGTATCTGAGAAGAGTTGG + Intergenic
1087726811 11:101727995-101728017 CTGCTGTTTCAGAGAAGAACTGG + Intronic
1088035994 11:105316442-105316464 CTCAGGTACCTGAAAAGAAAAGG - Intergenic
1088189477 11:107211930-107211952 CTGCTCTACCTGTGTAGACATGG + Intergenic
1088606007 11:111532897-111532919 CTGGTGTATTTGAGAAAAAAAGG - Intronic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1089625147 11:119746323-119746345 CTCCTGTTCTTTAGAAGAAAGGG + Intergenic
1090594651 11:128308192-128308214 CTGGATTATCTGAGAAGAAAAGG - Intergenic
1095164198 12:38952530-38952552 CTCCTGAAGCTGAGAAGAATGGG + Intergenic
1095817233 12:46437833-46437855 TTGCTTTACCGGAAAAGAAATGG - Intergenic
1095922173 12:47542545-47542567 CTCCAATACCTGAGAAGCAAGGG + Intergenic
1096099173 12:48958503-48958525 CTGCTGTAAATGAGGAGAGAGGG - Intergenic
1096222113 12:49837161-49837183 CTGATGTACCTAAGAACTAAGGG + Exonic
1097237711 12:57551031-57551053 CTACTGTACCTGGGACCAAAAGG - Intronic
1097324774 12:58264084-58264106 CTGTTGTTTCTGAAAAGAAATGG - Intergenic
1098544567 12:71697339-71697361 CTGCTGTACATGATAGAAAATGG + Exonic
1100005252 12:89887891-89887913 CTTCTGTACTTGAGAACCAAAGG + Intergenic
1100497018 12:95134952-95134974 CAGCTGTACCTTAAAATAAAAGG - Intronic
1100715837 12:97304276-97304298 CTCCTGCAGCTGAGAAGTAAAGG - Intergenic
1102270412 12:111529972-111529994 CTGATTTAGTTGAGAAGAAATGG - Intronic
1103250993 12:119499931-119499953 CTCCTCTACTTGTGAAGAAATGG - Intronic
1103963364 12:124622969-124622991 CTGCTGTACCGGCTCAGAAACGG - Intergenic
1105446679 13:20463031-20463053 CTCGTGTAACTAAGAAGAAACGG + Intronic
1106108262 13:26754047-26754069 CTGATGTACCTGTCTAGAAAAGG + Intergenic
1106889511 13:34228230-34228252 CTCCTGTTCCTGAGAGGAATCGG + Intergenic
1108963305 13:56264050-56264072 CTTTTGTTCCTGAGAGGAAAAGG + Intergenic
1109290288 13:60465873-60465895 TTGCTGTATGTGAGAAGAGATGG + Intronic
1109321370 13:60813668-60813690 CTGTTCTACAGGAGAAGAAAAGG - Intergenic
1109419656 13:62094936-62094958 CTGCTGTATCTGGAAAGAAGAGG - Intergenic
1110645133 13:77873849-77873871 CTGCTGTGCTTGAGTAGAAGTGG + Intergenic
1113296433 13:108964071-108964093 CTGCTCTGCCTGAGACGCAATGG + Intronic
1113443129 13:110345428-110345450 CTGCTGTTCCTGGGAAGCAGTGG + Intronic
1114064218 14:19046924-19046946 CTGCTTTAACTAAGAAGTAAAGG + Intergenic
1114098041 14:19353074-19353096 CTGCTTTAACTAAGAAGTAAAGG - Intergenic
1114911492 14:27204531-27204553 CTTCTGTCCCTGAGAACAAGTGG + Intergenic
1116133358 14:40889652-40889674 CTACTGTGCCTGACAAAAAAAGG + Intergenic
1117480377 14:56137934-56137956 CTTCTTTACCTGAGAAGTTATGG + Intronic
1117743441 14:58843132-58843154 CTGCTGGACATGAGTAGAGATGG - Intergenic
1117834874 14:59793415-59793437 CTTCTGTACTTAAGAAAAAAAGG - Intronic
1120834530 14:89027727-89027749 CTCCTGTCCGTAAGAAGAAAGGG + Intergenic
1121797762 14:96749494-96749516 CTCCTGTACCTGACAACAATAGG + Intergenic
1123904301 15:24906885-24906907 CTGCTGTCCCTTAGGAGAAGAGG + Intronic
1126999829 15:54489666-54489688 GTTGTGTACCTGAGAGGAAAAGG + Intronic
1129080633 15:73036730-73036752 CAGCTGTAACTCAGAAGAACTGG - Intergenic
1129880026 15:79000204-79000226 CTGCTGGACCTGAGAGGTGAAGG - Intronic
1130745254 15:86646501-86646523 CTGCCTAACCTGAGAGGAAAGGG + Intronic
1133778635 16:8918969-8918991 CTGATATACCTGAGAAGAAAGGG + Intronic
1135270130 16:21061994-21062016 GTGCTGTCACTGAGCAGAAATGG + Intronic
1137708841 16:50552726-50552748 CTGTTGAACCTGGGAAGGAAGGG + Intronic
1138701106 16:58864507-58864529 CAGCTGGACCTGAGAAACAACGG - Intergenic
1142666902 17:1468488-1468510 CTGCTGCAGCTGAGGAGACAAGG + Exonic
1143666580 17:8365565-8365587 CTGCAGAATCTGAAAAGAAATGG + Intergenic
1145053244 17:19680639-19680661 TTGCTGTGCCTGAGATGCAAAGG + Intronic
1148018751 17:44540024-44540046 CTGCTTTACATGAGAAGAGCGGG - Intergenic
1148645631 17:49218318-49218340 CTGCTGTTGGTGAGAAGAAGCGG + Intronic
1149432000 17:56601745-56601767 TTGCTGCAGCTGAAAAGAAATGG + Intergenic
1151382445 17:73735147-73735169 CTGCTCTACCTGAGGAGACATGG - Intergenic
1153924082 18:9817739-9817761 ATGCTGTACCTGTGCATAAAAGG - Intronic
1154391884 18:13944455-13944477 CTGCTGTACATAAATAGAAAAGG + Intergenic
1155928989 18:31685721-31685743 ATGCTGTACCTGAAAGGAAAAGG + Intronic
1156936727 18:42718257-42718279 CAGCACTACCGGAGAAGAAATGG - Intergenic
1157823873 18:50794762-50794784 CTGCTCTACCTCTGAAGAAGAGG + Intergenic
1159606918 18:70484380-70484402 CTGGTGTCCCTGAAAAGGAAGGG - Intergenic
1160629927 18:80239719-80239741 GTGCTGTAGCTGAGGGGAAAAGG - Intronic
1160845780 19:1165414-1165436 CTGCTGTCCCTGAGAACAGAAGG + Intronic
925062431 2:903595-903617 CTGCTTTGCCTCTGAAGAAAAGG - Intergenic
925825424 2:7843797-7843819 CAGCTTTACCTGGGAAGAACTGG - Intergenic
929627952 2:43429490-43429512 CTTGTCTACCTGAGCAGAAATGG - Intronic
929846222 2:45531128-45531150 CTGCTTTCCTTGAAAAGAAAAGG + Intronic
930144766 2:47990806-47990828 CTTCTGTAACTCAGAAGAAAAGG + Intergenic
933390726 2:81663409-81663431 CTCATTTACCTGAGGAGAAAAGG + Intergenic
933679811 2:85089758-85089780 CAGCTGGAACTGAGCAGAAATGG - Intergenic
934989152 2:98909366-98909388 CTGCTGTAACTTATAAGAAGGGG + Intronic
935694022 2:105755238-105755260 CAGCGGTAACTGTGAAGAAATGG + Intronic
936988624 2:118337624-118337646 GTGCTGGATCTGAGAGGAAAAGG + Intergenic
937999698 2:127722591-127722613 CTGCTGGAACTGAGCAGGAATGG + Exonic
938481480 2:131665936-131665958 CTGCTTTAACTAAGAAGTAAAGG + Intergenic
938973559 2:136454264-136454286 TTGCTATACCTGTTAAGAAAGGG + Intergenic
942497922 2:176559055-176559077 CTCCTGAAACTGAGAAGAGAGGG - Intergenic
943091756 2:183383955-183383977 CTGCTGTAACTGTCAGGAAAGGG + Intergenic
946262804 2:218509990-218510012 CTGCTGTTGGTGAGAGGAAAGGG + Exonic
946282767 2:218678338-218678360 TTGCTTTATCTGAGATGAAAAGG + Intronic
947978550 2:234388167-234388189 CAGCTGTGCCAGAGGAGAAAGGG + Intergenic
1169759220 20:9073308-9073330 CTCCTGTTCTAGAGAAGAAAGGG - Intronic
1171391941 20:24807224-24807246 CTTCTGAAGCTCAGAAGAAAAGG + Intergenic
1172405429 20:34685083-34685105 TTGTTGTAGCTGAGAAGGAAGGG + Intergenic
1175327181 20:58137891-58137913 CTGCTGTATCTGAGACACAAAGG - Intergenic
1175497008 20:59422295-59422317 CTGCTGAAGCTAAGAAGAACTGG + Intergenic
1180482711 22:15769557-15769579 CTGCTTTAACTAAGAAGTAAAGG + Intergenic
1180929456 22:19579120-19579142 CTGCTGGAATTGGGAAGAAAAGG + Intergenic
1181967263 22:26665956-26665978 GTGCTGAAACTGAGAAGAGAAGG - Intergenic
1184824087 22:46935326-46935348 CTGGAGTACATGAGAAAAAATGG + Intronic
1185033671 22:48459512-48459534 CTGCTGGACCTTAGGACAAATGG - Intergenic
1185240947 22:49746516-49746538 CAGGTTTACTTGAGAAGAAAAGG - Intergenic
949588705 3:5469794-5469816 CTTCTCCACCTGAGCAGAAATGG - Intergenic
951147420 3:19244603-19244625 CTGGTGAAGCTGTGAAGAAAAGG - Intronic
952111052 3:30124290-30124312 CTGCTGCACCTGGGAAGGACAGG + Intergenic
953269394 3:41425322-41425344 CTGGGGTACCTGAAAAGATACGG + Intronic
959424347 3:106167828-106167850 CTGGTGAAGCTGCGAAGAAAAGG + Intergenic
959613067 3:108316578-108316600 CTGGTGTACCTTGGAAGAGAAGG + Intronic
960121749 3:113954166-113954188 CTGGAGTGCCTGAGCAGAAAAGG + Exonic
960946477 3:122970211-122970233 CAGCTGTCCCTGAGAAGTGATGG - Intronic
961424842 3:126836908-126836930 CTGCTCTTCCTGAGGAGAAATGG + Intronic
965286031 3:166821916-166821938 GTTTTGTACTTGAGAAGAAAAGG - Intergenic
965431302 3:168592494-168592516 CTGCTTGAGCTGGGAAGAAATGG - Intergenic
967462067 3:189759153-189759175 CTGCTGGCCCTGAGAACACACGG - Intronic
967875860 3:194268104-194268126 CAGCTGAGCGTGAGAAGAAAGGG - Intergenic
969539291 4:7776527-7776549 CTGCTGTCCCTGAGTGGACAAGG - Intronic
970743585 4:19267166-19267188 CTGCTTTACCTCAGGAAAAAAGG - Intergenic
971173950 4:24262702-24262724 CTGCTTAACTTGAGAAGTAAAGG - Intergenic
971560933 4:28078806-28078828 CTGGTGTACCTGAGAATCATGGG + Intergenic
971756601 4:30716984-30717006 CTACTCAACCTGAGAGGAAAGGG - Intergenic
974431098 4:61797035-61797057 GTGCTATGCCTGAGAAGCAAAGG - Intronic
975415551 4:74100076-74100098 GTGCTGTCCCTGGGCAGAAAAGG + Intergenic
977607030 4:98994416-98994438 CTGTTGAACCTGAGAAGTCAAGG - Intergenic
978635543 4:110801098-110801120 CTGCTTTACATGTGAGGAAATGG + Intergenic
979286586 4:118932361-118932383 CTGCTGTAACTCTGAAGGAAAGG - Intronic
980744873 4:137000678-137000700 CAGCTGTACCTGAGAGGGCAGGG - Intergenic
981755363 4:148136494-148136516 ATGCTGTACCTGAGCAGGAAAGG - Intronic
982088045 4:151856129-151856151 CTGCTGAACCTGACAATATAGGG + Intergenic
983069796 4:163254476-163254498 CTTCTGAACCTGAGGGGAAAGGG + Intergenic
983120782 4:163881850-163881872 CTGTTGTACATGAGCAGACACGG + Intronic
983340739 4:166457317-166457339 TTGCTGTACTTAAGAAGGAAAGG + Intergenic
984171157 4:176360918-176360940 CTGCTGTACTTTAGGAGAAAGGG - Intergenic
986827493 5:11537498-11537520 CTACAATACCTGAGAAGAGATGG - Intronic
987985170 5:25136563-25136585 CTGCTCTACTTGAAAAGAGATGG - Intergenic
988718892 5:33856190-33856212 CTGCTGTAGCTCAGTGGAAAAGG + Intronic
988808574 5:34763259-34763281 CAGCTGTACGTGAGAAGAACTGG - Intronic
991398245 5:66226833-66226855 CAGCTGGACATGAAAAGAAAAGG - Intergenic
992077009 5:73201404-73201426 CTGCTATTCCTGAAAAGTAAAGG + Intergenic
992985462 5:82224447-82224469 CAGCTTTACCTAAGAAGCAAGGG + Intronic
993074477 5:83211300-83211322 CTGCTGTACCTGAGCTAAAGAGG + Intronic
994541740 5:101108318-101108340 CTGCTGTCCCACAGAAAAAAGGG + Intergenic
997996897 5:138593995-138594017 CTGCTGCAAATGAAAAGAAAGGG + Intergenic
998001684 5:138630777-138630799 CTGCTGTGGCTGAGAAGAGCTGG + Intronic
1000015629 5:157273217-157273239 CTGCACTTCCTGAGAAGACAAGG - Intronic
1000143727 5:158432559-158432581 GTGATGTACCTGAGCAGGAATGG + Intergenic
1000970423 5:167708414-167708436 CTTGTTTGCCTGAGAAGAAAGGG - Intronic
1003998960 6:11575417-11575439 CTGCTGCACCTAAGGAGAAACGG - Exonic
1004790632 6:19022341-19022363 CTGCTTCGCCTGATAAGAAATGG - Intergenic
1006227425 6:32551410-32551432 CTGATGCACATGGGAAGAAAAGG - Intergenic
1010284945 6:74065917-74065939 CTGCTGTGCCTGAGGAGCAGAGG + Intergenic
1012028096 6:94024113-94024135 CTGCTATCACTGAGAAGAAAAGG - Intergenic
1012369600 6:98487186-98487208 CTGCTATTCCTGAGCAGAATGGG - Intergenic
1014762932 6:125377787-125377809 CTGCTTTGCCCAAGAAGAAAGGG - Intergenic
1015528990 6:134201874-134201896 CTGATGTGCTGGAGAAGAAAGGG + Intronic
1015565235 6:134563185-134563207 TTGCGGTATCTGAGAAGACAGGG + Intergenic
1016851055 6:148619530-148619552 CTGCTGGAACTAATAAGAAAGGG - Intergenic
1018152115 6:160949907-160949929 CTTCTGTACCCTCGAAGAAAGGG - Intergenic
1020411458 7:7896243-7896265 CTGTTGAACCTGGGAAGAAGAGG + Intronic
1021346889 7:19539857-19539879 CATATGTACCTGAGAAGACATGG + Intergenic
1021462214 7:20901223-20901245 CAGCTGGACCTTTGAAGAAAGGG - Intergenic
1022455074 7:30551552-30551574 CTGCTTAAGCTGAGAAGTAAAGG + Intergenic
1024620616 7:51154281-51154303 CTGCTGGACCTCATAAGAACAGG + Intronic
1025220131 7:57100971-57100993 CTGTTGAACCTGGGAAGCAAAGG - Intergenic
1025630911 7:63272553-63272575 CTGTTGAACCTGGGAAGCAAAGG - Intergenic
1025651556 7:63474064-63474086 CTGTTGAACCTGGGAAGCAAAGG + Intergenic
1029820654 7:103143402-103143424 GTTCTGTTACTGAGAAGAAAAGG - Intronic
1032769678 7:135038523-135038545 CTGTTGTGCCTTAGATGAAATGG + Intronic
1035332502 7:158105487-158105509 CTGCTGTAGCTGAGTGGAGATGG - Intronic
1035569298 8:661376-661398 CTGCAGAGCCTGAGAAGAGAGGG - Intronic
1036405853 8:8454724-8454746 TGGCTGTACCTGAGAAGTCAAGG - Intergenic
1037405493 8:18538071-18538093 ATGCTGCACCTGAGGAAAAATGG + Intronic
1038361506 8:26884019-26884041 GAGCTGAACCTGAGCAGAAAAGG + Intergenic
1039032270 8:33323501-33323523 GTGCTGTGCCTGCAAAGAAAGGG + Intergenic
1039969081 8:42306421-42306443 CTGCAGTACCTGGTAAGAAGTGG + Exonic
1040762827 8:50871637-50871659 CTGCTATACCAGAAAATAAATGG + Intergenic
1044031661 8:87245954-87245976 CTGCTGTACTTTAAATGAAATGG - Intronic
1044393361 8:91679493-91679515 TTCCTGAAACTGAGAAGAAATGG + Intergenic
1046799964 8:118415196-118415218 CTCCTGTCCTTCAGAAGAAAAGG + Intronic
1047680608 8:127250601-127250623 CTCTGGTTCCTGAGAAGAAAGGG - Intergenic
1048533220 8:135269616-135269638 GTCCTATACCTGAGAAGAGATGG - Intergenic
1048944671 8:139433458-139433480 TTGCTTTGTCTGAGAAGAAAAGG - Intergenic
1049429811 8:142555676-142555698 CTGCTGGACCTGTCAAGAATTGG + Intergenic
1054779817 9:69155972-69155994 CTGCACTAGGTGAGAAGAAAAGG + Intronic
1054978930 9:71181149-71181171 GTGCTCTTCCTGAGAACAAAGGG + Intronic
1055607191 9:77983101-77983123 CTGCTGTACTGGGGTAGAAAGGG + Intronic
1055953850 9:81755909-81755931 CTCCTGTACCTTGGCAGAAAGGG - Intergenic
1058794468 9:108484436-108484458 TTGCTGTAGCTGAGAAGGGATGG - Intergenic
1059254236 9:112914104-112914126 TGACTTTACCTGAGAAGAAAGGG + Intergenic
1060023090 9:120149139-120149161 CTGCTGCCCCTGAGAAGAGGAGG - Intergenic
1203519777 Un_GL000213v1:34603-34625 CTGCGCTGCCTGGGAAGAAAGGG - Intergenic
1185983613 X:4806562-4806584 CTGCAATGCCTGAGAAGCAAGGG + Intergenic
1186739599 X:12503647-12503669 CTGCTGTGGTTGATAAGAAAGGG - Intronic
1186970502 X:14837182-14837204 CTACAGCACTTGAGAAGAAAAGG - Intergenic
1187289055 X:17934385-17934407 CTGCTGTACCTCACAAAACAAGG + Intergenic
1187368381 X:18683239-18683261 CTGCTGTACATGAGAACTACTGG - Intronic
1188186392 X:27120633-27120655 CTGCTGCAGCTGAGGAGAACAGG - Intergenic
1190981880 X:55463618-55463640 CTGCTGAAGCAGAGGAGAAATGG + Intergenic
1190986818 X:55509562-55509584 CTGCTGAAGCAGAGGAGAAATGG - Intergenic
1193755612 X:85405666-85405688 CTGGTGTACCTGAAAATAATGGG + Intergenic
1194479683 X:94405371-94405393 GTGCTGCAGCTGAGGAGAAAGGG - Intergenic
1194872665 X:99152706-99152728 CTGGAGTACCTGAGCTGAAAGGG + Intergenic
1195523368 X:105856656-105856678 CTGCTGTACCTAAGAAAATCAGG - Intronic
1198361780 X:135902773-135902795 CTGCTGGACTTGCTAAGAAATGG - Intronic
1199314654 X:146363061-146363083 CTCCTGTGCCTGAAAAAAAAGGG - Intergenic
1200062862 X:153491355-153491377 CTGCTGTAGCTTTGAAGACAGGG + Intronic