ID: 1067906287

View in Genome Browser
Species Human (GRCh38)
Location 10:50294680-50294702
Sequence GGCAATCACCAGGCTCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067906287_1067906300 22 Left 1067906287 10:50294680-50294702 CCTCCAAGAGCCTGGTGATTGCC No data
Right 1067906300 10:50294725-50294747 ATTACCACACACACCACTGGGGG No data
1067906287_1067906299 21 Left 1067906287 10:50294680-50294702 CCTCCAAGAGCCTGGTGATTGCC No data
Right 1067906299 10:50294724-50294746 CATTACCACACACACCACTGGGG No data
1067906287_1067906298 20 Left 1067906287 10:50294680-50294702 CCTCCAAGAGCCTGGTGATTGCC No data
Right 1067906298 10:50294723-50294745 CCATTACCACACACACCACTGGG No data
1067906287_1067906296 19 Left 1067906287 10:50294680-50294702 CCTCCAAGAGCCTGGTGATTGCC No data
Right 1067906296 10:50294722-50294744 CCCATTACCACACACACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067906287 Original CRISPR GGCAATCACCAGGCTCTTGG AGG (reversed) Intergenic
No off target data available for this crispr