ID: 1067906288

View in Genome Browser
Species Human (GRCh38)
Location 10:50294683-50294705
Sequence CAGGGCAATCACCAGGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067906288_1067906296 16 Left 1067906288 10:50294683-50294705 CCAAGAGCCTGGTGATTGCCCTG No data
Right 1067906296 10:50294722-50294744 CCCATTACCACACACACCACTGG No data
1067906288_1067906300 19 Left 1067906288 10:50294683-50294705 CCAAGAGCCTGGTGATTGCCCTG No data
Right 1067906300 10:50294725-50294747 ATTACCACACACACCACTGGGGG No data
1067906288_1067906298 17 Left 1067906288 10:50294683-50294705 CCAAGAGCCTGGTGATTGCCCTG No data
Right 1067906298 10:50294723-50294745 CCATTACCACACACACCACTGGG No data
1067906288_1067906299 18 Left 1067906288 10:50294683-50294705 CCAAGAGCCTGGTGATTGCCCTG No data
Right 1067906299 10:50294724-50294746 CATTACCACACACACCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067906288 Original CRISPR CAGGGCAATCACCAGGCTCT TGG (reversed) Intergenic
No off target data available for this crispr